Incidental Mutation 'R8891:Qdpr'
ID 677678
Institutional Source Beutler Lab
Gene Symbol Qdpr
Ensembl Gene ENSMUSG00000015806
Gene Name quinoid dihydropteridine reductase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock # R8891 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 45434021-45450236 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45447640 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 42 (N42S)
Ref Sequence ENSEMBL: ENSMUSP00000015950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015950] [ENSMUST00000117425] [ENSMUST00000118097] [ENSMUST00000120867] [ENSMUST00000127562] [ENSMUST00000154962] [ENSMUST00000197946] [ENSMUST00000198258]
AlphaFold Q8BVI4
Predicted Effect probably damaging
Transcript: ENSMUST00000015950
AA Change: N42S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000015950
Gene: ENSMUSG00000015806
AA Change: N42S

DomainStartEndE-ValueType
Pfam:adh_short 8 195 5.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117425
SMART Domains Protein: ENSMUSP00000112469
Gene: ENSMUSG00000015806

DomainStartEndE-ValueType
PDB:1DIR|D 1 189 1e-124 PDB
SCOP:d1hdr__ 7 189 4e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118097
SMART Domains Protein: ENSMUSP00000113958
Gene: ENSMUSG00000015806

DomainStartEndE-ValueType
PDB:1DIR|D 1 189 1e-124 PDB
SCOP:d1hdr__ 7 189 4e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120867
SMART Domains Protein: ENSMUSP00000113203
Gene: ENSMUSG00000015806

DomainStartEndE-ValueType
PDB:1DIR|D 1 189 1e-124 PDB
SCOP:d1hdr__ 7 189 4e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127562
AA Change: N59S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115453
Gene: ENSMUSG00000015806
AA Change: N59S

DomainStartEndE-ValueType
PDB:1DIR|D 1 137 7e-67 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000154962
SMART Domains Protein: ENSMUSP00000122081
Gene: ENSMUSG00000015806

DomainStartEndE-ValueType
PDB:1DIR|D 1 159 7e-72 PDB
SCOP:d1hdr__ 6 159 6e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000197946
AA Change: N42S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143584
Gene: ENSMUSG00000015806
AA Change: N42S

DomainStartEndE-ValueType
PDB:1DIR|D 1 213 1e-125 PDB
SCOP:d1hdr__ 6 162 2e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198258
SMART Domains Protein: ENSMUSP00000143741
Gene: ENSMUSG00000015806

DomainStartEndE-ValueType
PDB:1DIR|D 1 139 8e-86 PDB
SCOP:d1hdr__ 14 139 6e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the enzyme dihydropteridine reductase, which catalyzes the NADH-mediated reduction of quinonoid dihydrobiopterin. This enzyme is an essential component of the pterin-dependent aromatic amino acid hydroxylating systems. Mutations in this gene resulting in QDPR deficiency include aberrant splicing, amino acid substitutions, insertions, or premature terminations. Dihydropteridine reductase deficiency presents as atypical phenylketonuria due to insufficient production of biopterin, a cofactor for phenylalanine hydroxylase. [provided by RefSeq, Jul 2008]
PHENOTYPE: A portion of mice homozygous for a knock-out allele display abnormal rib-sternum attachment, a split xiphoid process, and lumbar vertebral transformation. Another knock-out allele exhibits abnormal folate and biopterin metabolism and oxidative stress in the liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,066,759 K570* probably null Het
Abi1 T C 2: 22,971,250 I99V probably damaging Het
Adgrg7 T A 16: 56,752,399 E351D probably benign Het
Ankrd34c T G 9: 89,730,090 K66T probably damaging Het
Asap2 C T 12: 21,112,143 R34W probably damaging Het
Atr A G 9: 95,905,760 T1469A probably benign Het
Btbd11 G A 10: 85,388,094 G256R unknown Het
Celsr1 G T 15: 85,937,993 R1708S probably benign Het
Chmp2a T A 7: 13,033,913 E28D probably benign Het
Cldn24 A T 8: 47,822,246 N35I probably benign Het
Coa6 G C 8: 126,422,831 probably null Het
Copa C T 1: 172,119,251 R1009C probably damaging Het
Crybb2 G A 5: 113,062,047 T150M possibly damaging Het
Ctnnd2 A T 15: 30,619,930 T143S probably benign Het
Eid3 A G 10: 82,867,158 N151S probably damaging Het
Fbxo17 G T 7: 28,735,308 V173L possibly damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Galntl6 T C 8: 57,962,399 N240S probably damaging Het
Gck G T 11: 5,901,733 S445R probably damaging Het
Gm21964 T A 8: 110,110,131 S216R possibly damaging Het
Gm5114 C A 7: 39,408,294 V634F probably benign Het
Gm8251 T C 1: 44,057,124 I1605V probably benign Het
Gnat2 G A 3: 108,098,318 D200N Het
H13 A G 2: 152,704,129 N390S probably benign Het
Helz T A 11: 107,662,016 M1206K probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kank1 G A 19: 25,410,075 G371R probably benign Het
Kif13b A G 14: 64,744,877 T513A probably damaging Het
L3mbtl4 T C 17: 68,455,786 S105P possibly damaging Het
Lpo T A 11: 87,807,022 E653V probably benign Het
Lyst A G 13: 13,712,850 D3088G possibly damaging Het
Man2b1 C A 8: 85,084,455 H72N probably damaging Het
Mast3 A T 8: 70,781,157 H981Q probably damaging Het
Meioc T A 11: 102,668,420 I56N probably benign Het
Mul1 A C 4: 138,434,853 K32Q probably benign Het
Oas1c C T 5: 120,808,061 S124N probably benign Het
Olfr1302 A T 2: 111,780,841 I174F probably damaging Het
Olfr437 A G 6: 43,167,816 I253V probably benign Het
Olfr794 A G 10: 129,571,177 H174R probably damaging Het
Omg T A 11: 79,503,003 K10* probably null Het
Pcdhb14 T A 18: 37,449,639 N599K probably damaging Het
Pcdhb18 C A 18: 37,490,647 N343K probably damaging Het
Phf7 C A 14: 31,249,656 probably benign Het
Pramef20 C T 4: 144,372,827 C456Y probably damaging Het
Rbm44 T A 1: 91,162,414 D716E probably benign Het
Rprd2 A C 3: 95,764,055 H1345Q possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Ryr2 G A 13: 11,799,882 A668V probably damaging Het
Sag T A 1: 87,831,961 L307Q probably damaging Het
Sash1 G A 10: 8,727,970 P1106L probably damaging Het
Sec16b T A 1: 157,554,839 I615N probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slco1b2 T C 6: 141,683,267 V600A probably benign Het
Sucnr1 A G 3: 60,086,842 T264A probably benign Het
Tbx3 A G 5: 119,671,918 probably benign Het
Tigd5 T C 15: 75,911,220 V477A possibly damaging Het
Ttc17 G A 2: 94,362,419 A89V probably damaging Het
Twsg1 A G 17: 65,948,662 I39T Het
Zfp184 T C 13: 21,959,342 F406S probably damaging Het
Zfp429 A T 13: 67,390,711 C205S probably damaging Het
Zfp59 T A 7: 27,854,888 D588E probably benign Het
Zfp64 A T 2: 168,955,163 M1K probably null Het
Other mutations in Qdpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02114:Qdpr APN 5 45434676 missense possibly damaging 0.93
R0907:Qdpr UTSW 5 45439386 missense probably benign 0.16
R1387:Qdpr UTSW 5 45450138 start gained probably benign
R1964:Qdpr UTSW 5 45439318 missense possibly damaging 0.58
R2431:Qdpr UTSW 5 45444730 missense probably damaging 1.00
R4586:Qdpr UTSW 5 45439327 missense possibly damaging 0.60
R5678:Qdpr UTSW 5 45447637 missense possibly damaging 0.65
R5754:Qdpr UTSW 5 45439385 missense probably damaging 0.98
R7392:Qdpr UTSW 5 45439376 missense probably benign 0.37
R7939:Qdpr UTSW 5 45450065 missense probably damaging 1.00
R8482:Qdpr UTSW 5 45439346 missense probably benign 0.05
R8993:Qdpr UTSW 5 45450044 missense probably damaging 1.00
R9445:Qdpr UTSW 5 45439327 missense probably benign
X0022:Qdpr UTSW 5 45439355 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGCCAAAATCAGCCAGTCAG -3'
(R):5'- AATTGCAAACTGGAAACGTTTCTGG -3'

Sequencing Primer
(F):5'- TCAGCCAGTCAGAAATAGAGCCTAG -3'
(R):5'- CAAACTGGAAACGTTTCTGGTCTTG -3'
Posted On 2021-08-02