Incidental Mutation 'R8891:Mast3'
ID 677691
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Name microtubule associated serine/threonine kinase 3
Synonyms
MMRRC Submission 068753-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8891 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 71230761-71257681 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 71233801 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 981 (H981Q)
Ref Sequence ENSEMBL: ENSMUSP00000148686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000166004] [ENSMUST00000211948]
AlphaFold Q3U214
Predicted Effect probably benign
Transcript: ENSMUST00000034296
SMART Domains Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
SH3 7 79 4e-7 SMART
RhoGAP 122 286 2.36e-18 SMART
low complexity region 291 311 N/A INTRINSIC
SH2 322 405 4.51e-26 SMART
Pfam:PI3K_P85_iSH2 422 590 1.7e-64 PFAM
SH2 614 696 9.96e-28 SMART
low complexity region 713 718 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166004
AA Change: H997Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: H997Q

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211948
AA Change: H981Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000212140
AA Change: H232Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 137,772,520 (GRCm39) K570* probably null Het
Abi1 T C 2: 22,861,262 (GRCm39) I99V probably damaging Het
Abtb3 G A 10: 85,223,958 (GRCm39) G256R unknown Het
Adgrg7 T A 16: 56,572,762 (GRCm39) E351D probably benign Het
Ankrd34c T G 9: 89,612,143 (GRCm39) K66T probably damaging Het
Asap2 C T 12: 21,162,144 (GRCm39) R34W probably damaging Het
Atr A G 9: 95,787,813 (GRCm39) T1469A probably benign Het
Ccdc168 T C 1: 44,096,284 (GRCm39) I1605V probably benign Het
Celsr1 G T 15: 85,822,194 (GRCm39) R1708S probably benign Het
Chmp2a T A 7: 12,767,840 (GRCm39) E28D probably benign Het
Cldn24 A T 8: 48,275,281 (GRCm39) N35I probably benign Het
Coa6 G C 8: 127,149,570 (GRCm39) probably null Het
Copa C T 1: 171,946,818 (GRCm39) R1009C probably damaging Het
Crybb2 G A 5: 113,209,913 (GRCm39) T150M possibly damaging Het
Ctnnd2 A T 15: 30,620,076 (GRCm39) T143S probably benign Het
Eid3 A G 10: 82,702,992 (GRCm39) N151S probably damaging Het
Fbxo17 G T 7: 28,434,733 (GRCm39) V173L possibly damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,436,769 (GRCm39) probably benign Het
Galntl6 T C 8: 58,415,433 (GRCm39) N240S probably damaging Het
Gck G T 11: 5,851,733 (GRCm39) S445R probably damaging Het
Gm5114 C A 7: 39,057,718 (GRCm39) V634F probably benign Het
Gnat2 G A 3: 108,005,634 (GRCm39) D200N Het
H13 A G 2: 152,546,049 (GRCm39) N390S probably benign Het
Helz T A 11: 107,552,842 (GRCm39) M1206K probably damaging Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Kank1 G A 19: 25,387,439 (GRCm39) G371R probably benign Het
Kif13b A G 14: 64,982,326 (GRCm39) T513A probably damaging Het
L3mbtl4 T C 17: 68,762,781 (GRCm39) S105P possibly damaging Het
Lpo T A 11: 87,697,848 (GRCm39) E653V probably benign Het
Lyst A G 13: 13,887,435 (GRCm39) D3088G possibly damaging Het
Man2b1 C A 8: 85,811,084 (GRCm39) H72N probably damaging Het
Meioc T A 11: 102,559,246 (GRCm39) I56N probably benign Het
Mul1 A C 4: 138,162,164 (GRCm39) K32Q probably benign Het
Oas1c C T 5: 120,946,126 (GRCm39) S124N probably benign Het
Omg T A 11: 79,393,829 (GRCm39) K10* probably null Het
Or2a52 A G 6: 43,144,750 (GRCm39) I253V probably benign Het
Or4k52 A T 2: 111,611,186 (GRCm39) I174F probably damaging Het
Or6c88 A G 10: 129,407,046 (GRCm39) H174R probably damaging Het
Pcdhb14 T A 18: 37,582,692 (GRCm39) N599K probably damaging Het
Pcdhb18 C A 18: 37,623,700 (GRCm39) N343K probably damaging Het
Phf7 C A 14: 30,971,613 (GRCm39) probably benign Het
Pramel15 C T 4: 144,099,397 (GRCm39) C456Y probably damaging Het
Qdpr T C 5: 45,604,982 (GRCm39) N42S probably damaging Het
Rbm44 T A 1: 91,090,136 (GRCm39) D716E probably benign Het
Rprd2 A C 3: 95,671,367 (GRCm39) H1345Q possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,229,116 (GRCm39) probably benign Het
Ryr2 G A 13: 11,814,768 (GRCm39) A668V probably damaging Het
Sag T A 1: 87,759,683 (GRCm39) L307Q probably damaging Het
Sash1 G A 10: 8,603,734 (GRCm39) P1106L probably damaging Het
Sec16b T A 1: 157,382,409 (GRCm39) I615N probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,103,384 (GRCm39) probably benign Het
Slco1b2 T C 6: 141,628,993 (GRCm39) V600A probably benign Het
Sucnr1 A G 3: 59,994,263 (GRCm39) T264A probably benign Het
Tbx3 A G 5: 119,809,983 (GRCm39) probably benign Het
Tigd5 T C 15: 75,783,069 (GRCm39) V477A possibly damaging Het
Tle7 T A 8: 110,836,763 (GRCm39) S216R possibly damaging Het
Ttc17 G A 2: 94,192,764 (GRCm39) A89V probably damaging Het
Twsg1 A G 17: 66,255,657 (GRCm39) I39T Het
Zfp184 T C 13: 22,143,512 (GRCm39) F406S probably damaging Het
Zfp429 A T 13: 67,538,830 (GRCm39) C205S probably damaging Het
Zfp59 T A 7: 27,554,313 (GRCm39) D588E probably benign Het
Zfp64 A T 2: 168,797,083 (GRCm39) M1K probably null Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 71,233,327 (GRCm39) splice site probably benign
IGL01411:Mast3 APN 8 71,232,227 (GRCm39) missense possibly damaging 0.50
IGL01475:Mast3 APN 8 71,232,174 (GRCm39) missense probably damaging 1.00
IGL01886:Mast3 APN 8 71,234,783 (GRCm39) missense possibly damaging 0.94
IGL02104:Mast3 APN 8 71,240,550 (GRCm39) missense possibly damaging 0.78
IGL02236:Mast3 APN 8 71,241,888 (GRCm39) missense probably benign 0.36
IGL02437:Mast3 APN 8 71,233,202 (GRCm39) missense possibly damaging 0.79
IGL02704:Mast3 APN 8 71,239,519 (GRCm39) missense probably damaging 1.00
IGL03155:Mast3 APN 8 71,241,861 (GRCm39) missense probably damaging 1.00
IGL03366:Mast3 APN 8 71,234,207 (GRCm39) nonsense probably null
gravy UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
stuffing UTSW 8 71,237,441 (GRCm39) frame shift probably null
turkey UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
BB010:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
BB020:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R0037:Mast3 UTSW 8 71,236,343 (GRCm39) critical splice donor site probably null
R0280:Mast3 UTSW 8 71,240,564 (GRCm39) missense possibly damaging 0.65
R0280:Mast3 UTSW 8 71,236,439 (GRCm39) missense probably damaging 1.00
R0731:Mast3 UTSW 8 71,233,965 (GRCm39) missense probably damaging 1.00
R1101:Mast3 UTSW 8 71,239,307 (GRCm39) missense probably damaging 1.00
R1177:Mast3 UTSW 8 71,232,968 (GRCm39) missense probably damaging 1.00
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1333:Mast3 UTSW 8 71,233,938 (GRCm39) missense probably damaging 1.00
R1543:Mast3 UTSW 8 71,244,955 (GRCm39) missense possibly damaging 0.93
R1544:Mast3 UTSW 8 71,238,816 (GRCm39) missense probably damaging 1.00
R1738:Mast3 UTSW 8 71,237,200 (GRCm39) missense probably benign 0.38
R1842:Mast3 UTSW 8 71,233,037 (GRCm39) missense possibly damaging 0.91
R1936:Mast3 UTSW 8 71,237,444 (GRCm39) missense probably damaging 1.00
R2015:Mast3 UTSW 8 71,240,007 (GRCm39) missense probably benign 0.00
R2219:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R2220:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R3711:Mast3 UTSW 8 71,232,251 (GRCm39) missense probably benign 0.13
R3919:Mast3 UTSW 8 71,232,066 (GRCm39) missense probably benign 0.02
R4027:Mast3 UTSW 8 71,240,552 (GRCm39) missense probably damaging 1.00
R4060:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4061:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4062:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4063:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4588:Mast3 UTSW 8 71,233,251 (GRCm39) nonsense probably null
R4672:Mast3 UTSW 8 71,237,441 (GRCm39) frame shift probably null
R4770:Mast3 UTSW 8 71,238,864 (GRCm39) missense probably damaging 1.00
R4822:Mast3 UTSW 8 71,233,010 (GRCm39) missense probably damaging 1.00
R4830:Mast3 UTSW 8 71,241,559 (GRCm39) missense possibly damaging 0.87
R5196:Mast3 UTSW 8 71,240,889 (GRCm39) missense probably damaging 1.00
R5333:Mast3 UTSW 8 71,236,145 (GRCm39) missense probably benign 0.03
R5428:Mast3 UTSW 8 71,237,377 (GRCm39) missense possibly damaging 0.95
R5656:Mast3 UTSW 8 71,238,865 (GRCm39) missense probably damaging 1.00
R5920:Mast3 UTSW 8 71,240,577 (GRCm39) missense probably benign 0.00
R6177:Mast3 UTSW 8 71,242,662 (GRCm39) missense probably damaging 1.00
R6186:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
R6407:Mast3 UTSW 8 71,234,772 (GRCm39) missense probably benign 0.02
R6614:Mast3 UTSW 8 71,234,610 (GRCm39) missense possibly damaging 0.95
R6804:Mast3 UTSW 8 71,239,376 (GRCm39) missense probably benign 0.29
R6873:Mast3 UTSW 8 71,239,236 (GRCm39) nonsense probably null
R6930:Mast3 UTSW 8 71,252,115 (GRCm39) nonsense probably null
R6948:Mast3 UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
R7084:Mast3 UTSW 8 71,232,117 (GRCm39) missense probably benign 0.14
R7253:Mast3 UTSW 8 71,242,326 (GRCm39) critical splice donor site probably null
R7316:Mast3 UTSW 8 71,232,432 (GRCm39) missense probably damaging 1.00
R7357:Mast3 UTSW 8 71,237,503 (GRCm39) missense probably damaging 1.00
R7405:Mast3 UTSW 8 71,238,815 (GRCm39) missense probably damaging 1.00
R7429:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7430:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7521:Mast3 UTSW 8 71,241,412 (GRCm39) missense probably benign 0.16
R7576:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R7933:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R7998:Mast3 UTSW 8 71,236,214 (GRCm39) missense probably benign
R8021:Mast3 UTSW 8 71,240,896 (GRCm39) missense probably benign 0.02
R8204:Mast3 UTSW 8 71,240,925 (GRCm39) missense probably benign 0.00
R8327:Mast3 UTSW 8 71,232,062 (GRCm39) missense probably damaging 1.00
R8357:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8415:Mast3 UTSW 8 71,233,866 (GRCm39) missense probably damaging 1.00
R8457:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8530:Mast3 UTSW 8 71,240,877 (GRCm39) missense possibly damaging 0.92
R8930:Mast3 UTSW 8 71,234,377 (GRCm39) splice site probably benign
R9002:Mast3 UTSW 8 71,233,904 (GRCm39) missense probably damaging 1.00
R9085:Mast3 UTSW 8 71,249,361 (GRCm39) missense unknown
R9087:Mast3 UTSW 8 71,242,330 (GRCm39) missense possibly damaging 0.93
R9148:Mast3 UTSW 8 71,233,091 (GRCm39) missense probably damaging 0.98
R9364:Mast3 UTSW 8 71,238,826 (GRCm39) missense probably damaging 1.00
R9779:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
Z1177:Mast3 UTSW 8 71,241,682 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACTGACTCCCCATTGATGTGTG -3'
(R):5'- AATGAGTGTTCTTCCCACCC -3'

Sequencing Primer
(F):5'- TGTGATGAGGTCCCCAGCAC -3'
(R):5'- TCTACAGACGACGGCAGC -3'
Posted On 2021-08-02