Mutagenetix > Incidental Mutation

Incidental Mutation 'R8891:Mast3'

677691

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8891 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 70781157 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 981 (H981Q)

Ref Sequence

ENSEMBL: ENSMUSP00000148686 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000166004] [ENSMUST00000211948]

AlphaFold

Q3U214

Predicted Effect

probably benign
Transcript: ENSMUST00000034296

SMART Domains

Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834

Domain	Start	End	E-Value	Type
SH3	7	79	4e-7	SMART
RhoGAP	122	286	2.36e-18	SMART
low complexity region	291	311	N/A	INTRINSIC
SH2	322	405	4.51e-26	SMART
Pfam:PI3K_P85_iSH2	422	590	1.7e-64	PFAM
SH2	614	696	9.96e-28	SMART
low complexity region	713	718	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000166004
AA Change: H997Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: H997Q

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000211948
AA Change: H981Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000212140
AA Change: H232Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	T	3: 138,066,759	K570*	probably null	Het
Abi1	T	C	2: 22,971,250	I99V	probably damaging	Het
Adgrg7	T	A	16: 56,752,399	E351D	probably benign	Het
Ankrd34c	T	G	9: 89,730,090	K66T	probably damaging	Het
Asap2	C	T	12: 21,112,143	R34W	probably damaging	Het
Atr	A	G	9: 95,905,760	T1469A	probably benign	Het
Btbd11	G	A	10: 85,388,094	G256R	unknown	Het
Celsr1	G	T	15: 85,937,993	R1708S	probably benign	Het
Chmp2a	T	A	7: 13,033,913	E28D	probably benign	Het
Cldn24	A	T	8: 47,822,246	N35I	probably benign	Het
Coa6	G	C	8: 126,422,831		probably null	Het
Copa	C	T	1: 172,119,251	R1009C	probably damaging	Het
Crybb2	G	A	5: 113,062,047	T150M	possibly damaging	Het
Ctnnd2	A	T	15: 30,619,930	T143S	probably benign	Het
Eid3	A	G	10: 82,867,158	N151S	probably damaging	Het
Fbxo17	G	T	7: 28,735,308	V173L	possibly damaging	Het
Fmn2	CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC	CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC	1: 174,609,203		probably benign	Het
Galntl6	T	C	8: 57,962,399	N240S	probably damaging	Het
Gck	G	T	11: 5,901,733	S445R	probably damaging	Het
Gm21964	T	A	8: 110,110,131	S216R	possibly damaging	Het
Gm5114	C	A	7: 39,408,294	V634F	probably benign	Het
Gm8251	T	C	1: 44,057,124	I1605V	probably benign	Het
Gnat2	G	A	3: 108,098,318	D200N		Het
H13	A	G	2: 152,704,129	N390S	probably benign	Het
Helz	T	A	11: 107,662,016	M1206K	probably damaging	Het
Itpr3	G	A	17: 27,118,677		probably benign	Het
Kank1	G	A	19: 25,410,075	G371R	probably benign	Het
Kif13b	A	G	14: 64,744,877	T513A	probably damaging	Het
L3mbtl4	T	C	17: 68,455,786	S105P	possibly damaging	Het
Lpo	T	A	11: 87,807,022	E653V	probably benign	Het
Lyst	A	G	13: 13,712,850	D3088G	possibly damaging	Het
Man2b1	C	A	8: 85,084,455	H72N	probably damaging	Het
Meioc	T	A	11: 102,668,420	I56N	probably benign	Het
Mul1	A	C	4: 138,434,853	K32Q	probably benign	Het
Oas1c	C	T	5: 120,808,061	S124N	probably benign	Het
Olfr1302	A	T	2: 111,780,841	I174F	probably damaging	Het
Olfr437	A	G	6: 43,167,816	I253V	probably benign	Het
Olfr794	A	G	10: 129,571,177	H174R	probably damaging	Het
Omg	T	A	11: 79,503,003	K10*	probably null	Het
Pcdhb14	T	A	18: 37,449,639	N599K	probably damaging	Het
Pcdhb18	C	A	18: 37,490,647	N343K	probably damaging	Het
Phf7	C	A	14: 31,249,656		probably benign	Het
Pramef20	C	T	4: 144,372,827	C456Y	probably damaging	Het
Qdpr	T	C	5: 45,447,640	N42S	probably damaging	Het
Rbm44	T	A	1: 91,162,414	D716E	probably benign	Het
Rprd2	A	C	3: 95,764,055	H1345Q	possibly damaging	Het
Rsf1	G	GACGGCGGCT	7: 97,579,909		probably benign	Het
Ryr2	G	A	13: 11,799,882	A668V	probably damaging	Het
Sag	T	A	1: 87,831,961	L307Q	probably damaging	Het
Sash1	G	A	10: 8,727,970	P1106L	probably damaging	Het
Sec16b	T	A	1: 157,554,839	I615N	probably damaging	Het
Sfi1	A	ATCTTCCCAAAGCCAGTGC	11: 3,153,384		probably benign	Het
Slco1b2	T	C	6: 141,683,267	V600A	probably benign	Het
Sucnr1	A	G	3: 60,086,842	T264A	probably benign	Het
Tbx3	A	G	5: 119,671,918		probably benign	Het
Tigd5	T	C	15: 75,911,220	V477A	possibly damaging	Het
Ttc17	G	A	2: 94,362,419	A89V	probably damaging	Het
Twsg1	A	G	17: 65,948,662	I39T		Het
Zfp184	T	C	13: 21,959,342	F406S	probably damaging	Het
Zfp429	A	T	13: 67,390,711	C205S	probably damaging	Het
Zfp59	T	A	7: 27,854,888	D588E	probably benign	Het
Zfp64	A	T	2: 168,955,163	M1K	probably null	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
gravy	UTSW	8	70786635	missense	probably damaging	1.00
stuffing	UTSW	8	70784797	frame shift	probably null
turkey	UTSW	8	70785482	missense	probably damaging	1.00
BB010:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
BB020:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0280:Mast3	UTSW	8	70787920	missense	possibly damaging	0.65
R0731:Mast3	UTSW	8	70781321	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	70780324	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	70784556	missense	probably benign	0.38
R1842:Mast3	UTSW	8	70780393	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	70784800	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2219:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	70779607	missense	probably benign	0.13
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4027:Mast3	UTSW	8	70787908	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	70780607	nonsense	probably null
R4672:Mast3	UTSW	8	70784797	frame shift	probably null
R4770:Mast3	UTSW	8	70786220	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	70788245	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	70783501	missense	probably benign	0.03
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	70787933	missense	probably benign	0.00
R6177:Mast3	UTSW	8	70790018	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	70782128	missense	probably benign	0.02
R6614:Mast3	UTSW	8	70781966	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6930:Mast3	UTSW	8	70799471	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7253:Mast3	UTSW	8	70789682	critical splice donor site	probably null
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	70784859	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	70786171	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16
R7576:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R7933:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R7998:Mast3	UTSW	8	70783570	missense	probably benign
R8021:Mast3	UTSW	8	70788252	missense	probably benign	0.02
R8204:Mast3	UTSW	8	70788281	missense	probably benign	0.00
R8327:Mast3	UTSW	8	70779418	missense	probably damaging	1.00
R8357:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8415:Mast3	UTSW	8	70781222	missense	probably damaging	1.00
R8457:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8530:Mast3	UTSW	8	70788233	missense	possibly damaging	0.92
R8930:Mast3	UTSW	8	70781733	splice site	probably benign
R9002:Mast3	UTSW	8	70781260	missense	probably damaging	1.00
R9085:Mast3	UTSW	8	70796717	missense	unknown
R9087:Mast3	UTSW	8	70789686	missense	possibly damaging	0.93
R9148:Mast3	UTSW	8	70780447	missense	probably damaging	0.98
R9364:Mast3	UTSW	8	70786182	missense	probably damaging	1.00
R9779:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
Z1177:Mast3	UTSW	8	70789038	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACTGACTCCCCATTGATGTGTG -3'
(R):5'- AATGAGTGTTCTTCCCACCC -3'

Sequencing Primer
(F):5'- TGTGATGAGGTCCCCAGCAC -3'
(R):5'- TCTACAGACGACGGCAGC -3'

Posted On

2021-08-02