Incidental Mutation 'R8891:Mast3'
ID 677691
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Name microtubule associated serine/threonine kinase 3
Synonyms
Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8891 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 70778117-70805054 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 70781157 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 981 (H981Q)
Ref Sequence ENSEMBL: ENSMUSP00000148686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000166004] [ENSMUST00000211948]
AlphaFold Q3U214
Predicted Effect probably benign
Transcript: ENSMUST00000034296
SMART Domains Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
SH3 7 79 4e-7 SMART
RhoGAP 122 286 2.36e-18 SMART
low complexity region 291 311 N/A INTRINSIC
SH2 322 405 4.51e-26 SMART
Pfam:PI3K_P85_iSH2 422 590 1.7e-64 PFAM
SH2 614 696 9.96e-28 SMART
low complexity region 713 718 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166004
AA Change: H997Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: H997Q

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211948
AA Change: H981Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000212140
AA Change: H232Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,066,759 K570* probably null Het
Abi1 T C 2: 22,971,250 I99V probably damaging Het
Adgrg7 T A 16: 56,752,399 E351D probably benign Het
Ankrd34c T G 9: 89,730,090 K66T probably damaging Het
Asap2 C T 12: 21,112,143 R34W probably damaging Het
Atr A G 9: 95,905,760 T1469A probably benign Het
Btbd11 G A 10: 85,388,094 G256R unknown Het
Celsr1 G T 15: 85,937,993 R1708S probably benign Het
Chmp2a T A 7: 13,033,913 E28D probably benign Het
Cldn24 A T 8: 47,822,246 N35I probably benign Het
Coa6 G C 8: 126,422,831 probably null Het
Copa C T 1: 172,119,251 R1009C probably damaging Het
Crybb2 G A 5: 113,062,047 T150M possibly damaging Het
Ctnnd2 A T 15: 30,619,930 T143S probably benign Het
Eid3 A G 10: 82,867,158 N151S probably damaging Het
Fbxo17 G T 7: 28,735,308 V173L possibly damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Galntl6 T C 8: 57,962,399 N240S probably damaging Het
Gck G T 11: 5,901,733 S445R probably damaging Het
Gm21964 T A 8: 110,110,131 S216R possibly damaging Het
Gm5114 C A 7: 39,408,294 V634F probably benign Het
Gm8251 T C 1: 44,057,124 I1605V probably benign Het
Gnat2 G A 3: 108,098,318 D200N Het
H13 A G 2: 152,704,129 N390S probably benign Het
Helz T A 11: 107,662,016 M1206K probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kank1 G A 19: 25,410,075 G371R probably benign Het
Kif13b A G 14: 64,744,877 T513A probably damaging Het
L3mbtl4 T C 17: 68,455,786 S105P possibly damaging Het
Lpo T A 11: 87,807,022 E653V probably benign Het
Lyst A G 13: 13,712,850 D3088G possibly damaging Het
Man2b1 C A 8: 85,084,455 H72N probably damaging Het
Meioc T A 11: 102,668,420 I56N probably benign Het
Mul1 A C 4: 138,434,853 K32Q probably benign Het
Oas1c C T 5: 120,808,061 S124N probably benign Het
Olfr1302 A T 2: 111,780,841 I174F probably damaging Het
Olfr437 A G 6: 43,167,816 I253V probably benign Het
Olfr794 A G 10: 129,571,177 H174R probably damaging Het
Omg T A 11: 79,503,003 K10* probably null Het
Pcdhb14 T A 18: 37,449,639 N599K probably damaging Het
Pcdhb18 C A 18: 37,490,647 N343K probably damaging Het
Phf7 C A 14: 31,249,656 probably benign Het
Pramef20 C T 4: 144,372,827 C456Y probably damaging Het
Qdpr T C 5: 45,447,640 N42S probably damaging Het
Rbm44 T A 1: 91,162,414 D716E probably benign Het
Rprd2 A C 3: 95,764,055 H1345Q possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Ryr2 G A 13: 11,799,882 A668V probably damaging Het
Sag T A 1: 87,831,961 L307Q probably damaging Het
Sash1 G A 10: 8,727,970 P1106L probably damaging Het
Sec16b T A 1: 157,554,839 I615N probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slco1b2 T C 6: 141,683,267 V600A probably benign Het
Sucnr1 A G 3: 60,086,842 T264A probably benign Het
Tbx3 A G 5: 119,671,918 probably benign Het
Tigd5 T C 15: 75,911,220 V477A possibly damaging Het
Ttc17 G A 2: 94,362,419 A89V probably damaging Het
Twsg1 A G 17: 65,948,662 I39T Het
Zfp184 T C 13: 21,959,342 F406S probably damaging Het
Zfp429 A T 13: 67,390,711 C205S probably damaging Het
Zfp59 T A 7: 27,854,888 D588E probably benign Het
Zfp64 A T 2: 168,955,163 M1K probably null Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 70780683 splice site probably benign
IGL01411:Mast3 APN 8 70779583 missense possibly damaging 0.50
IGL01475:Mast3 APN 8 70779530 missense probably damaging 1.00
IGL01886:Mast3 APN 8 70782139 missense possibly damaging 0.94
IGL02104:Mast3 APN 8 70787906 missense possibly damaging 0.78
IGL02236:Mast3 APN 8 70789244 missense probably benign 0.36
IGL02437:Mast3 APN 8 70780558 missense possibly damaging 0.79
IGL02704:Mast3 APN 8 70786875 missense probably damaging 1.00
IGL03155:Mast3 APN 8 70789217 missense probably damaging 1.00
IGL03366:Mast3 APN 8 70781563 nonsense probably null
gravy UTSW 8 70786635 missense probably damaging 1.00
stuffing UTSW 8 70784797 frame shift probably null
turkey UTSW 8 70785482 missense probably damaging 1.00
BB010:Mast3 UTSW 8 70786635 missense probably damaging 1.00
BB020:Mast3 UTSW 8 70786635 missense probably damaging 1.00
R0037:Mast3 UTSW 8 70783699 critical splice donor site probably null
R0280:Mast3 UTSW 8 70783795 missense probably damaging 1.00
R0280:Mast3 UTSW 8 70787920 missense possibly damaging 0.65
R0731:Mast3 UTSW 8 70781321 missense probably damaging 1.00
R1101:Mast3 UTSW 8 70786663 missense probably damaging 1.00
R1177:Mast3 UTSW 8 70780324 missense probably damaging 1.00
R1208:Mast3 UTSW 8 70788272 splice site probably null
R1208:Mast3 UTSW 8 70788272 splice site probably null
R1333:Mast3 UTSW 8 70781294 missense probably damaging 1.00
R1543:Mast3 UTSW 8 70792311 missense possibly damaging 0.93
R1544:Mast3 UTSW 8 70786172 missense probably damaging 1.00
R1738:Mast3 UTSW 8 70784556 missense probably benign 0.38
R1842:Mast3 UTSW 8 70780393 missense possibly damaging 0.91
R1936:Mast3 UTSW 8 70784800 missense probably damaging 1.00
R2015:Mast3 UTSW 8 70787363 missense probably benign 0.00
R2219:Mast3 UTSW 8 70780963 missense probably damaging 0.99
R2220:Mast3 UTSW 8 70780963 missense probably damaging 0.99
R3711:Mast3 UTSW 8 70779607 missense probably benign 0.13
R3919:Mast3 UTSW 8 70779422 missense probably benign 0.02
R4027:Mast3 UTSW 8 70787908 missense probably damaging 1.00
R4060:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4061:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4062:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4063:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4588:Mast3 UTSW 8 70780607 nonsense probably null
R4672:Mast3 UTSW 8 70784797 frame shift probably null
R4770:Mast3 UTSW 8 70786220 missense probably damaging 1.00
R4822:Mast3 UTSW 8 70780366 missense probably damaging 1.00
R4830:Mast3 UTSW 8 70788915 missense possibly damaging 0.87
R5196:Mast3 UTSW 8 70788245 missense probably damaging 1.00
R5333:Mast3 UTSW 8 70783501 missense probably benign 0.03
R5428:Mast3 UTSW 8 70784733 missense possibly damaging 0.95
R5656:Mast3 UTSW 8 70786221 missense probably damaging 1.00
R5920:Mast3 UTSW 8 70787933 missense probably benign 0.00
R6177:Mast3 UTSW 8 70790018 missense probably damaging 1.00
R6186:Mast3 UTSW 8 70785483 missense probably damaging 1.00
R6407:Mast3 UTSW 8 70782128 missense probably benign 0.02
R6614:Mast3 UTSW 8 70781966 missense possibly damaging 0.95
R6804:Mast3 UTSW 8 70786732 missense probably benign 0.29
R6873:Mast3 UTSW 8 70786592 nonsense probably null
R6930:Mast3 UTSW 8 70799471 nonsense probably null
R6948:Mast3 UTSW 8 70785482 missense probably damaging 1.00
R7084:Mast3 UTSW 8 70779473 missense probably benign 0.14
R7253:Mast3 UTSW 8 70789682 critical splice donor site probably null
R7316:Mast3 UTSW 8 70779788 missense probably damaging 1.00
R7357:Mast3 UTSW 8 70784859 missense probably damaging 1.00
R7405:Mast3 UTSW 8 70786171 missense probably damaging 1.00
R7429:Mast3 UTSW 8 70780303 missense probably damaging 1.00
R7430:Mast3 UTSW 8 70780303 missense probably damaging 1.00
R7521:Mast3 UTSW 8 70788768 missense probably benign 0.16
R7576:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R7933:Mast3 UTSW 8 70786635 missense probably damaging 1.00
R7998:Mast3 UTSW 8 70783570 missense probably benign
R8021:Mast3 UTSW 8 70788252 missense probably benign 0.02
R8204:Mast3 UTSW 8 70788281 missense probably benign 0.00
R8327:Mast3 UTSW 8 70779418 missense probably damaging 1.00
R8357:Mast3 UTSW 8 70780441 missense probably benign 0.39
R8415:Mast3 UTSW 8 70781222 missense probably damaging 1.00
R8457:Mast3 UTSW 8 70780441 missense probably benign 0.39
R8530:Mast3 UTSW 8 70788233 missense possibly damaging 0.92
R8930:Mast3 UTSW 8 70781733 splice site probably benign
R9002:Mast3 UTSW 8 70781260 missense probably damaging 1.00
R9085:Mast3 UTSW 8 70796717 missense unknown
R9087:Mast3 UTSW 8 70789686 missense possibly damaging 0.93
R9148:Mast3 UTSW 8 70780447 missense probably damaging 0.98
R9364:Mast3 UTSW 8 70786182 missense probably damaging 1.00
Z1177:Mast3 UTSW 8 70789038 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACTGACTCCCCATTGATGTGTG -3'
(R):5'- AATGAGTGTTCTTCCCACCC -3'

Sequencing Primer
(F):5'- TGTGATGAGGTCCCCAGCAC -3'
(R):5'- TCTACAGACGACGGCAGC -3'
Posted On 2021-08-02