Incidental Mutation 'R8891:Omg'
ID 677703
Institutional Source Beutler Lab
Gene Symbol Omg
Ensembl Gene ENSMUSG00000049612
Gene Name oligodendrocyte myelin glycoprotein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8891 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 79500982-79504084 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 79503003 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 10 (K10*)
Ref Sequence ENSEMBL: ENSMUSP00000132918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071325] [ENSMUST00000108251] [ENSMUST00000164465]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000071325
SMART Domains Protein: ENSMUSP00000071289
Gene: ENSMUSG00000020716

DomainStartEndE-ValueType
RasGAP 1189 1559 2.56e-151 SMART
SEC14 1585 1737 2.36e-11 SMART
low complexity region 2619 2629 N/A INTRINSIC
low complexity region 2750 2763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108251
SMART Domains Protein: ENSMUSP00000103886
Gene: ENSMUSG00000020716

DomainStartEndE-ValueType
RasGAP 1189 1538 1.23e-153 SMART
SEC14 1564 1716 2.36e-11 SMART
low complexity region 2598 2608 N/A INTRINSIC
low complexity region 2729 2742 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164465
AA Change: K10*
SMART Domains Protein: ENSMUSP00000132918
Gene: ENSMUSG00000049612
AA Change: K10*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LRRNT 28 62 5.02e-10 SMART
LRR 80 103 1.07e0 SMART
LRR_TYP 148 171 1.18e-2 SMART
LRR 172 192 2.33e2 SMART
LRR_TYP 193 216 4.01e-5 SMART
low complexity region 427 442 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit improved recovery from spinal cord injuries when on a mixed 129S4/SvJae C57BL/6 background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,066,759 K570* probably null Het
Abi1 T C 2: 22,971,250 I99V probably damaging Het
Adgrg7 T A 16: 56,752,399 E351D probably benign Het
Ankrd34c T G 9: 89,730,090 K66T probably damaging Het
Asap2 C T 12: 21,112,143 R34W probably damaging Het
Atr A G 9: 95,905,760 T1469A probably benign Het
Btbd11 G A 10: 85,388,094 G256R unknown Het
Celsr1 G T 15: 85,937,993 R1708S probably benign Het
Chmp2a T A 7: 13,033,913 E28D probably benign Het
Cldn24 A T 8: 47,822,246 N35I probably benign Het
Coa6 G C 8: 126,422,831 probably null Het
Copa C T 1: 172,119,251 R1009C probably damaging Het
Crybb2 G A 5: 113,062,047 T150M possibly damaging Het
Ctnnd2 A T 15: 30,619,930 T143S probably benign Het
Eid3 A G 10: 82,867,158 N151S probably damaging Het
Fbxo17 G T 7: 28,735,308 V173L possibly damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Galntl6 T C 8: 57,962,399 N240S probably damaging Het
Gck G T 11: 5,901,733 S445R probably damaging Het
Gm21964 T A 8: 110,110,131 S216R possibly damaging Het
Gm5114 C A 7: 39,408,294 V634F probably benign Het
Gm8251 T C 1: 44,057,124 I1605V probably benign Het
Gnat2 G A 3: 108,098,318 D200N Het
H13 A G 2: 152,704,129 N390S probably benign Het
Helz T A 11: 107,662,016 M1206K probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kank1 G A 19: 25,410,075 G371R probably benign Het
Kif13b A G 14: 64,744,877 T513A probably damaging Het
L3mbtl4 T C 17: 68,455,786 S105P possibly damaging Het
Lpo T A 11: 87,807,022 E653V probably benign Het
Lyst A G 13: 13,712,850 D3088G possibly damaging Het
Man2b1 C A 8: 85,084,455 H72N probably damaging Het
Mast3 A T 8: 70,781,157 H981Q probably damaging Het
Meioc T A 11: 102,668,420 I56N probably benign Het
Mul1 A C 4: 138,434,853 K32Q probably benign Het
Oas1c C T 5: 120,808,061 S124N probably benign Het
Olfr1302 A T 2: 111,780,841 I174F probably damaging Het
Olfr437 A G 6: 43,167,816 I253V probably benign Het
Olfr794 A G 10: 129,571,177 H174R probably damaging Het
Pcdhb14 T A 18: 37,449,639 N599K probably damaging Het
Pcdhb18 C A 18: 37,490,647 N343K probably damaging Het
Phf7 C A 14: 31,249,656 probably benign Het
Pramef20 C T 4: 144,372,827 C456Y probably damaging Het
Qdpr T C 5: 45,447,640 N42S probably damaging Het
Rbm44 T A 1: 91,162,414 D716E probably benign Het
Rprd2 A C 3: 95,764,055 H1345Q possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Ryr2 G A 13: 11,799,882 A668V probably damaging Het
Sag T A 1: 87,831,961 L307Q probably damaging Het
Sash1 G A 10: 8,727,970 P1106L probably damaging Het
Sec16b T A 1: 157,554,839 I615N probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slco1b2 T C 6: 141,683,267 V600A probably benign Het
Sucnr1 A G 3: 60,086,842 T264A probably benign Het
Tbx3 A G 5: 119,671,918 probably benign Het
Tigd5 T C 15: 75,911,220 V477A possibly damaging Het
Ttc17 G A 2: 94,362,419 A89V probably damaging Het
Twsg1 A G 17: 65,948,662 I39T Het
Zfp184 T C 13: 21,959,342 F406S probably damaging Het
Zfp429 A T 13: 67,390,711 C205S probably damaging Het
Zfp59 T A 7: 27,854,888 D588E probably benign Het
Zfp64 A T 2: 168,955,163 M1K probably null Het
Other mutations in Omg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Omg APN 11 79503913 utr 5 prime probably benign
IGL00850:Omg APN 11 79502714 missense possibly damaging 0.71
IGL01863:Omg APN 11 79502224 missense probably benign
IGL03034:Omg APN 11 79502121 missense possibly damaging 0.53
E0374:Omg UTSW 11 79502949 missense probably benign 0.16
R0125:Omg UTSW 11 79502853 missense possibly damaging 0.53
R0413:Omg UTSW 11 79502835 missense possibly damaging 0.73
R1636:Omg UTSW 11 79502340 missense probably benign 0.21
R1659:Omg UTSW 11 79502900 missense possibly damaging 0.86
R1713:Omg UTSW 11 79502853 missense probably benign 0.03
R1882:Omg UTSW 11 79501719 intron probably benign
R3974:Omg UTSW 11 79502398 missense probably benign
R4668:Omg UTSW 11 79502423 missense probably damaging 0.98
R5560:Omg UTSW 11 79501758 missense possibly damaging 0.96
R6230:Omg UTSW 11 79502958 missense probably benign 0.03
R6803:Omg UTSW 11 79502268 missense possibly damaging 0.53
R6983:Omg UTSW 11 79501938 missense probably benign 0.00
R7557:Omg UTSW 11 79502853 missense possibly damaging 0.53
R7719:Omg UTSW 11 79502233 missense probably benign 0.33
R8014:Omg UTSW 11 79502903 missense possibly damaging 0.92
R8389:Omg UTSW 11 79502175 missense probably benign 0.01
R8425:Omg UTSW 11 79502000 missense possibly damaging 0.72
R9203:Omg UTSW 11 79502225 missense probably benign 0.00
Z1088:Omg UTSW 11 79502320 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- CTGGTTATGCAGATCAGTAAAGTGG -3'
(R):5'- GCCCCAATTGAAGGATTAGGC -3'

Sequencing Primer
(F):5'- GCAGATCAGTAAAGTGGTTATAAGAC -3'
(R):5'- CCCCAATTGAAGGATTAGGCATTTGG -3'
Posted On 2021-08-02