Incidental Mutation 'R8891:Lpo'
ID 677704
Institutional Source Beutler Lab
Gene Symbol Lpo
Ensembl Gene ENSMUSG00000009356
Gene Name lactoperoxidase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8891 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 87806428-87828289 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 87807022 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 653 (E653V)
Ref Sequence ENSEMBL: ENSMUSP00000099466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020779] [ENSMUST00000103177] [ENSMUST00000121303] [ENSMUST00000146650]
AlphaFold Q5SW46
Predicted Effect probably benign
Transcript: ENSMUST00000020779
SMART Domains Protein: ENSMUSP00000020779
Gene: ENSMUSG00000009350

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:An_peroxidase 147 692 4.2e-183 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103177
AA Change: E653V

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000099466
Gene: ENSMUSG00000009356
AA Change: E653V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:An_peroxidase 136 682 1.8e-180 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121303
SMART Domains Protein: ENSMUSP00000112837
Gene: ENSMUSG00000009350

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:An_peroxidase 147 692 4.2e-183 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146650
SMART Domains Protein: ENSMUSP00000128484
Gene: ENSMUSG00000009350

DomainStartEndE-ValueType
Pfam:An_peroxidase 1 112 2.4e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peroxidase family of proteins. The encoded preproprotein is proteolytically processed to generate the mature enzyme. Following its secretion from salivary, mammary, and other mucosal glands, this enzyme catalyzes the generation of the antimicrobial substance hypothiocyanous acid. This gene is present in a gene cluster on chromosome 17. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,066,759 K570* probably null Het
Abi1 T C 2: 22,971,250 I99V probably damaging Het
Adgrg7 T A 16: 56,752,399 E351D probably benign Het
Ankrd34c T G 9: 89,730,090 K66T probably damaging Het
Asap2 C T 12: 21,112,143 R34W probably damaging Het
Atr A G 9: 95,905,760 T1469A probably benign Het
Btbd11 G A 10: 85,388,094 G256R unknown Het
Celsr1 G T 15: 85,937,993 R1708S probably benign Het
Chmp2a T A 7: 13,033,913 E28D probably benign Het
Cldn24 A T 8: 47,822,246 N35I probably benign Het
Coa6 G C 8: 126,422,831 probably null Het
Copa C T 1: 172,119,251 R1009C probably damaging Het
Crybb2 G A 5: 113,062,047 T150M possibly damaging Het
Ctnnd2 A T 15: 30,619,930 T143S probably benign Het
Eid3 A G 10: 82,867,158 N151S probably damaging Het
Fbxo17 G T 7: 28,735,308 V173L possibly damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Galntl6 T C 8: 57,962,399 N240S probably damaging Het
Gck G T 11: 5,901,733 S445R probably damaging Het
Gm21964 T A 8: 110,110,131 S216R possibly damaging Het
Gm5114 C A 7: 39,408,294 V634F probably benign Het
Gm8251 T C 1: 44,057,124 I1605V probably benign Het
Gnat2 G A 3: 108,098,318 D200N Het
H13 A G 2: 152,704,129 N390S probably benign Het
Helz T A 11: 107,662,016 M1206K probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kank1 G A 19: 25,410,075 G371R probably benign Het
Kif13b A G 14: 64,744,877 T513A probably damaging Het
L3mbtl4 T C 17: 68,455,786 S105P possibly damaging Het
Lyst A G 13: 13,712,850 D3088G possibly damaging Het
Man2b1 C A 8: 85,084,455 H72N probably damaging Het
Mast3 A T 8: 70,781,157 H981Q probably damaging Het
Meioc T A 11: 102,668,420 I56N probably benign Het
Mul1 A C 4: 138,434,853 K32Q probably benign Het
Oas1c C T 5: 120,808,061 S124N probably benign Het
Olfr1302 A T 2: 111,780,841 I174F probably damaging Het
Olfr437 A G 6: 43,167,816 I253V probably benign Het
Olfr794 A G 10: 129,571,177 H174R probably damaging Het
Omg T A 11: 79,503,003 K10* probably null Het
Pcdhb14 T A 18: 37,449,639 N599K probably damaging Het
Pcdhb18 C A 18: 37,490,647 N343K probably damaging Het
Phf7 C A 14: 31,249,656 probably benign Het
Pramef20 C T 4: 144,372,827 C456Y probably damaging Het
Qdpr T C 5: 45,447,640 N42S probably damaging Het
Rbm44 T A 1: 91,162,414 D716E probably benign Het
Rprd2 A C 3: 95,764,055 H1345Q possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Ryr2 G A 13: 11,799,882 A668V probably damaging Het
Sag T A 1: 87,831,961 L307Q probably damaging Het
Sash1 G A 10: 8,727,970 P1106L probably damaging Het
Sec16b T A 1: 157,554,839 I615N probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slco1b2 T C 6: 141,683,267 V600A probably benign Het
Sucnr1 A G 3: 60,086,842 T264A probably benign Het
Tbx3 A G 5: 119,671,918 probably benign Het
Tigd5 T C 15: 75,911,220 V477A possibly damaging Het
Ttc17 G A 2: 94,362,419 A89V probably damaging Het
Twsg1 A G 17: 65,948,662 I39T Het
Zfp184 T C 13: 21,959,342 F406S probably damaging Het
Zfp429 A T 13: 67,390,711 C205S probably damaging Het
Zfp59 T A 7: 27,854,888 D588E probably benign Het
Zfp64 A T 2: 168,955,163 M1K probably null Het
Other mutations in Lpo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Lpo APN 11 87821138 missense probably benign 0.43
IGL01833:Lpo APN 11 87807333 missense possibly damaging 0.81
IGL02413:Lpo APN 11 87806906 missense possibly damaging 0.87
IGL02706:Lpo APN 11 87817773 missense probably benign 0.02
IGL02865:Lpo APN 11 87806977 missense possibly damaging 0.80
IGL02939:Lpo APN 11 87815178 missense possibly damaging 0.85
R1072:Lpo UTSW 11 87818434 missense probably damaging 1.00
R1169:Lpo UTSW 11 87817317 missense possibly damaging 0.58
R1667:Lpo UTSW 11 87807241 unclassified probably benign
R1719:Lpo UTSW 11 87809192 splice site probably null
R2133:Lpo UTSW 11 87821130 missense probably benign 0.17
R2871:Lpo UTSW 11 87816524 missense possibly damaging 0.51
R2871:Lpo UTSW 11 87816524 missense possibly damaging 0.51
R4382:Lpo UTSW 11 87822201 missense probably benign 0.14
R4657:Lpo UTSW 11 87814347 missense probably damaging 1.00
R4936:Lpo UTSW 11 87810340 missense probably benign 0.02
R4969:Lpo UTSW 11 87806925 missense probably benign 0.09
R5368:Lpo UTSW 11 87821069 missense possibly damaging 0.61
R5536:Lpo UTSW 11 87816563 missense probably damaging 1.00
R6246:Lpo UTSW 11 87822232 missense unknown
R6556:Lpo UTSW 11 87817763 nonsense probably null
R6817:Lpo UTSW 11 87809241 missense probably benign
R7024:Lpo UTSW 11 87816443 missense probably damaging 1.00
R7203:Lpo UTSW 11 87809251 missense possibly damaging 0.75
R7206:Lpo UTSW 11 87807423 missense probably damaging 1.00
R8355:Lpo UTSW 11 87814288 missense probably damaging 1.00
R8455:Lpo UTSW 11 87814288 missense probably damaging 1.00
R8693:Lpo UTSW 11 87809240 missense probably benign 0.04
R8848:Lpo UTSW 11 87817777 missense probably benign 0.00
R8989:Lpo UTSW 11 87817834 missense probably benign 0.00
RF010:Lpo UTSW 11 87821102 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATGGCATCTCGGACCATGG -3'
(R):5'- CCCCAAAATTCTTCATGAGGTC -3'

Sequencing Primer
(F):5'- ATCTCGGACCATGGACATGTTCG -3'
(R):5'- CATGAGGTCTGACTCCATACC -3'
Posted On 2021-08-02