Incidental Mutation 'R8891:Meioc'
ID 677705
Institutional Source Beutler Lab
Gene Symbol Meioc
Ensembl Gene ENSMUSG00000051455
Gene Name meiosis specific with coiled-coil domain
Synonyms Gm1564, LOC380729, LOC268491
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock # R8891 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 102663716-102682237 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 102668420 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 56 (I56N)
Ref Sequence ENSEMBL: ENSMUSP00000116246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100378] [ENSMUST00000156590]
AlphaFold A2AG06
Predicted Effect probably benign
Transcript: ENSMUST00000100378
AA Change: I112N

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097947
Gene: ENSMUSG00000051455
AA Change: I112N

DomainStartEndE-ValueType
low complexity region 526 537 N/A INTRINSIC
low complexity region 712 728 N/A INTRINSIC
Pfam:DUF4582 757 922 5.1e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156590
AA Change: I56N

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116246
Gene: ENSMUSG00000051455
AA Change: I56N

DomainStartEndE-ValueType
low complexity region 470 481 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit infertility with small gonads, absent germ cells and arrested meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,066,759 K570* probably null Het
Abi1 T C 2: 22,971,250 I99V probably damaging Het
Adgrg7 T A 16: 56,752,399 E351D probably benign Het
Ankrd34c T G 9: 89,730,090 K66T probably damaging Het
Asap2 C T 12: 21,112,143 R34W probably damaging Het
Atr A G 9: 95,905,760 T1469A probably benign Het
Btbd11 G A 10: 85,388,094 G256R unknown Het
Celsr1 G T 15: 85,937,993 R1708S probably benign Het
Chmp2a T A 7: 13,033,913 E28D probably benign Het
Cldn24 A T 8: 47,822,246 N35I probably benign Het
Coa6 G C 8: 126,422,831 probably null Het
Copa C T 1: 172,119,251 R1009C probably damaging Het
Crybb2 G A 5: 113,062,047 T150M possibly damaging Het
Ctnnd2 A T 15: 30,619,930 T143S probably benign Het
Eid3 A G 10: 82,867,158 N151S probably damaging Het
Fbxo17 G T 7: 28,735,308 V173L possibly damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Galntl6 T C 8: 57,962,399 N240S probably damaging Het
Gck G T 11: 5,901,733 S445R probably damaging Het
Gm21964 T A 8: 110,110,131 S216R possibly damaging Het
Gm5114 C A 7: 39,408,294 V634F probably benign Het
Gm8251 T C 1: 44,057,124 I1605V probably benign Het
Gnat2 G A 3: 108,098,318 D200N Het
H13 A G 2: 152,704,129 N390S probably benign Het
Helz T A 11: 107,662,016 M1206K probably damaging Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kank1 G A 19: 25,410,075 G371R probably benign Het
Kif13b A G 14: 64,744,877 T513A probably damaging Het
L3mbtl4 T C 17: 68,455,786 S105P possibly damaging Het
Lpo T A 11: 87,807,022 E653V probably benign Het
Lyst A G 13: 13,712,850 D3088G possibly damaging Het
Man2b1 C A 8: 85,084,455 H72N probably damaging Het
Mast3 A T 8: 70,781,157 H981Q probably damaging Het
Mul1 A C 4: 138,434,853 K32Q probably benign Het
Oas1c C T 5: 120,808,061 S124N probably benign Het
Olfr1302 A T 2: 111,780,841 I174F probably damaging Het
Olfr437 A G 6: 43,167,816 I253V probably benign Het
Olfr794 A G 10: 129,571,177 H174R probably damaging Het
Omg T A 11: 79,503,003 K10* probably null Het
Pcdhb14 T A 18: 37,449,639 N599K probably damaging Het
Pcdhb18 C A 18: 37,490,647 N343K probably damaging Het
Phf7 C A 14: 31,249,656 probably benign Het
Pramef20 C T 4: 144,372,827 C456Y probably damaging Het
Qdpr T C 5: 45,447,640 N42S probably damaging Het
Rbm44 T A 1: 91,162,414 D716E probably benign Het
Rprd2 A C 3: 95,764,055 H1345Q possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Ryr2 G A 13: 11,799,882 A668V probably damaging Het
Sag T A 1: 87,831,961 L307Q probably damaging Het
Sash1 G A 10: 8,727,970 P1106L probably damaging Het
Sec16b T A 1: 157,554,839 I615N probably damaging Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Slco1b2 T C 6: 141,683,267 V600A probably benign Het
Sucnr1 A G 3: 60,086,842 T264A probably benign Het
Tbx3 A G 5: 119,671,918 probably benign Het
Tigd5 T C 15: 75,911,220 V477A possibly damaging Het
Ttc17 G A 2: 94,362,419 A89V probably damaging Het
Twsg1 A G 17: 65,948,662 I39T Het
Zfp184 T C 13: 21,959,342 F406S probably damaging Het
Zfp429 A T 13: 67,390,711 C205S probably damaging Het
Zfp59 T A 7: 27,854,888 D588E probably benign Het
Zfp64 A T 2: 168,955,163 M1K probably null Het
Other mutations in Meioc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Meioc APN 11 102674287 missense probably benign 0.33
IGL01952:Meioc APN 11 102672185 missense possibly damaging 0.79
IGL02006:Meioc APN 11 102674266 missense probably damaging 1.00
IGL02195:Meioc APN 11 102674857 missense possibly damaging 0.91
IGL02339:Meioc APN 11 102668448 missense probably benign 0.18
IGL02935:Meioc APN 11 102672191 missense probably benign 0.06
IGL03294:Meioc APN 11 102680669 missense probably damaging 1.00
PIT4519001:Meioc UTSW 11 102679957 missense probably damaging 1.00
R0285:Meioc UTSW 11 102672191 missense probably benign 0.06
R0964:Meioc UTSW 11 102680031 missense probably damaging 1.00
R1074:Meioc UTSW 11 102675393 missense probably damaging 1.00
R2024:Meioc UTSW 11 102675358 missense probably benign 0.00
R4012:Meioc UTSW 11 102675828 missense probably damaging 0.99
R4429:Meioc UTSW 11 102675720 missense probably damaging 1.00
R4491:Meioc UTSW 11 102674920 missense possibly damaging 0.84
R4594:Meioc UTSW 11 102674166 missense probably damaging 1.00
R4752:Meioc UTSW 11 102674433 missense probably benign 0.00
R5301:Meioc UTSW 11 102680045 missense probably damaging 1.00
R5352:Meioc UTSW 11 102675313 missense probably benign 0.03
R5646:Meioc UTSW 11 102675257 missense possibly damaging 0.94
R5958:Meioc UTSW 11 102675153 missense probably benign 0.41
R5968:Meioc UTSW 11 102675831 missense probably damaging 0.99
R6157:Meioc UTSW 11 102668401 missense probably damaging 1.00
R6410:Meioc UTSW 11 102675034 missense probably benign 0.00
R6644:Meioc UTSW 11 102668460 critical splice donor site probably null
R7285:Meioc UTSW 11 102666342 missense probably benign 0.00
R7440:Meioc UTSW 11 102674237 missense possibly damaging 0.67
R7815:Meioc UTSW 11 102675588 missense probably damaging 1.00
R7984:Meioc UTSW 11 102674606 missense possibly damaging 0.94
R8009:Meioc UTSW 11 102676743 missense probably damaging 1.00
R8078:Meioc UTSW 11 102668400 nonsense probably null
R8195:Meioc UTSW 11 102675067 nonsense probably null
R8429:Meioc UTSW 11 102674206 missense probably benign 0.06
R8797:Meioc UTSW 11 102676860 nonsense probably null
R8854:Meioc UTSW 11 102675763 missense probably damaging 0.98
R9081:Meioc UTSW 11 102674175 missense probably benign 0.00
R9360:Meioc UTSW 11 102674953 missense probably benign 0.13
Z1177:Meioc UTSW 11 102666364 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGAGTTCTTGAGTAGCTATCCCAAC -3'
(R):5'- TCCAGCACTCAAGAGATAAGGC -3'

Sequencing Primer
(F):5'- TGAGTAGCTATCCCAACTTCTAAC -3'
(R):5'- AGGTAACAAATATGAAGCCAACTTAC -3'
Posted On 2021-08-02