Incidental Mutation 'R8892:Xrcc5'
ID 677724
Institutional Source Beutler Lab
Gene Symbol Xrcc5
Ensembl Gene ENSMUSG00000026187
Gene Name X-ray repair complementing defective repair in Chinese hamster cells 5
Synonyms Ku86, Ku80
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8892 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 72307421-72394952 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 72343031 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 455 (D455E)
Ref Sequence ENSEMBL: ENSMUSP00000027379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027379]
AlphaFold P27641
Predicted Effect possibly damaging
Transcript: ENSMUST00000027379
AA Change: D455E

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027379
Gene: ENSMUSG00000026187
AA Change: D455E

DomainStartEndE-ValueType
VWA 7 245 8.07e-2 SMART
Ku78 302 441 8.9e-52 SMART
Pfam:Ku_C 476 570 6.9e-23 PFAM
Pfam:Ku_PK_bind 594 707 9.3e-31 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.6%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the 80-kilodalton subunit of the Ku heterodimer protein which is also known as ATP-dependant DNA helicase II or DNA repair protein XRCC5. Ku is the DNA-binding component of the DNA-dependent protein kinase, and it functions together with the DNA ligase IV-XRCC4 complex in the repair of DNA double-strand break by non-homologous end joining and the completion of V(D)J recombination events. This gene functionally complements Chinese hamster xrs-6, a mutant defective in DNA double-strand break repair and in ability to undergo V(D)J recombination. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants are defective in DNA double-strand break repair and show impaired growth and severe combined immunodeficiency due to defective assembly of TCRs and immunoglobulins. Mutants die early with osteopenia, atrophic skin and hepatic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T A 7: 120,216,383 L285I probably damaging Het
Abcc2 T G 19: 43,807,132 S442R possibly damaging Het
Adgrl3 A T 5: 81,726,669 I938F probably damaging Het
Adpgk A G 9: 59,310,340 Y212C probably damaging Het
Ahcyl1 C T 3: 107,672,062 D219N probably benign Het
Ap3b1 G A 13: 94,542,840 V997M unknown Het
Bbs1 A C 19: 4,892,926 S479A probably benign Het
Bean1 A T 8: 104,216,978 D231V probably damaging Het
Cacnb1 A T 11: 98,010,366 V220E probably damaging Het
Camkv C T 9: 107,946,134 R120* probably null Het
Ccny T G 18: 9,345,235 S180R probably damaging Het
Cdh23 G T 10: 60,307,505 H3012Q probably damaging Het
Chd9 A G 8: 90,933,840 N476S unknown Het
Clasp2 T A 9: 113,880,183 L680Q probably damaging Het
Clip1 A T 5: 123,579,502 S1241R probably benign Het
Cramp1l C T 17: 24,983,140 G456D probably damaging Het
Csmd3 T A 15: 47,741,238 K1036N Het
Ctnna1 G A 18: 35,239,533 V514I possibly damaging Het
Ddr1 A C 17: 35,682,664 I852S probably benign Het
Dhrs1 G A 14: 55,739,947 A238V possibly damaging Het
Echs1 A C 7: 140,108,118 L258R probably damaging Het
Epha8 G T 4: 136,934,539 H582N probably benign Het
Fhod3 G A 18: 25,056,395 probably null Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm960 A G 19: 4,649,693 V494A possibly damaging Het
Gpr179 T C 11: 97,335,764 D1855G possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ipo9 T C 1: 135,386,806 N904S possibly damaging Het
Itih3 A G 14: 30,915,678 V508A probably benign Het
Klhl14 T G 18: 21,558,163 T437P possibly damaging Het
Krt5 T C 15: 101,710,750 M268V probably benign Het
Lama4 T A 10: 39,097,198 L1587Q probably damaging Het
Lhx4 T C 1: 155,705,267 T171A possibly damaging Het
Lrfn2 A C 17: 49,070,348 E152D probably damaging Het
Ltn1 A T 16: 87,432,342 probably benign Het
Ly9 A T 1: 171,593,897 D595E possibly damaging Het
Macf1 A G 4: 123,355,243 L7165P probably damaging Het
Magi3 C T 3: 104,050,825 G648D probably damaging Het
Mgll T A 6: 88,766,324 C109S unknown Het
Micall2 T A 5: 139,717,499 H194L probably damaging Het
Mindy4 T C 6: 55,278,238 L567P probably benign Het
Mmp16 T A 4: 18,051,820 Y270N probably damaging Het
Naa16 A T 14: 79,390,576 F14I probably benign Het
Nme6 T G 9: 109,839,638 F41V probably damaging Het
Npffr1 A G 10: 61,614,160 N71S possibly damaging Het
Olfr1287 A G 2: 111,449,622 I161V probably benign Het
Olfr362 C A 2: 37,105,511 L46F probably damaging Het
Olfr409-ps1 T C 11: 74,317,123 W33R probably damaging Het
Pard3b T A 1: 62,637,867 Y1186N probably damaging Het
Pou2f1 A T 1: 165,880,458 S552T unknown Het
Ppp2r3c A T 12: 55,289,668 L233Q possibly damaging Het
Prl8a1 G A 13: 27,582,086 H9Y possibly damaging Het
Rnf135 C T 11: 80,184,131 T72I probably benign Het
Rsf1 A T 7: 97,678,964 I1058F Het
Slc39a6 A T 18: 24,596,329 Y442* probably null Het
Slc44a2 G A 9: 21,341,857 probably benign Het
Slc4a11 T G 2: 130,687,220 S437R probably damaging Het
Spc24 G A 9: 21,757,698 Q98* probably null Het
Spock3 T A 8: 62,951,952 Y51* probably null Het
Sptbn1 A G 11: 30,117,800 Y1805H probably benign Het
Tango6 A G 8: 106,742,213 I780M probably benign Het
Tcerg1l C T 7: 138,397,531 W41* probably null Het
Tdrd9 A G 12: 112,013,284 Y401C probably benign Het
Tex47 A T 5: 7,305,115 I99F probably damaging Het
Tlr9 G A 9: 106,222,635 probably benign Het
Tmem209 T A 6: 30,497,943 S276C possibly damaging Het
Tmprss11f A C 5: 86,539,759 S97A possibly damaging Het
Ttc7 T A 17: 87,330,092 M425K probably damaging Het
Ttn C T 2: 76,909,122 G3737D unknown Het
Tyk2 T C 9: 21,116,167 H503R probably benign Het
Unc13b A T 4: 43,176,484 R2437S unknown Het
Uqcrc1 C T 9: 108,937,118 R58C probably damaging Het
Vmn1r160 G A 7: 22,872,049 V276I probably benign Het
Vmn2r112 A G 17: 22,618,631 Y691C probably damaging Het
Vmn2r87 A C 10: 130,472,236 I711S probably damaging Het
Vmn2r94 A G 17: 18,244,073 S652P possibly damaging Het
Vps50 T A 6: 3,536,967 C313S probably damaging Het
Zdhhc6 T A 19: 55,302,555 probably benign Het
Zfp964 G A 8: 69,663,755 G335D probably damaging Het
Other mutations in Xrcc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Xrcc5 APN 1 72354245 missense probably benign 0.01
IGL01599:Xrcc5 APN 1 72346349 missense possibly damaging 0.72
IGL01714:Xrcc5 APN 1 72329984 missense probably damaging 0.98
IGL02740:Xrcc5 APN 1 72340081 critical splice donor site probably null
IGL02884:Xrcc5 APN 1 72346237 missense possibly damaging 0.95
barbarian UTSW 1 72314178 missense probably damaging 1.00
durio UTSW 1 72339029 missense probably damaging 1.00
Highlander UTSW 1 72319127 missense possibly damaging 0.55
R6935_Xrcc5_229 UTSW 1 72343030 missense possibly damaging 0.82
xenophobe UTSW 1 72312436 missense probably damaging 1.00
zibethinus UTSW 1 72310458 missense probably damaging 1.00
PIT4362001:Xrcc5 UTSW 1 72393929 missense probably benign
R0309:Xrcc5 UTSW 1 72307576 unclassified probably benign
R0485:Xrcc5 UTSW 1 72338945 splice site probably benign
R1004:Xrcc5 UTSW 1 72383778 splice site probably benign
R1421:Xrcc5 UTSW 1 72310477 missense probably benign 0.00
R1530:Xrcc5 UTSW 1 72329944 missense probably damaging 0.98
R1694:Xrcc5 UTSW 1 72319096 missense possibly damaging 0.88
R1750:Xrcc5 UTSW 1 72325087 nonsense probably null
R2037:Xrcc5 UTSW 1 72346370 missense probably benign 0.01
R2296:Xrcc5 UTSW 1 72346326 missense probably benign 0.00
R4299:Xrcc5 UTSW 1 72394720 makesense probably null
R4388:Xrcc5 UTSW 1 72330030 missense possibly damaging 0.46
R4527:Xrcc5 UTSW 1 72312500 missense probably damaging 1.00
R4857:Xrcc5 UTSW 1 72326265 missense possibly damaging 0.92
R5073:Xrcc5 UTSW 1 72339029 missense probably damaging 1.00
R5233:Xrcc5 UTSW 1 72340050 missense probably damaging 1.00
R5521:Xrcc5 UTSW 1 72346271 missense probably damaging 1.00
R5996:Xrcc5 UTSW 1 72310458 missense probably damaging 1.00
R6583:Xrcc5 UTSW 1 72312593 critical splice donor site probably null
R6638:Xrcc5 UTSW 1 72383362 missense possibly damaging 0.94
R6935:Xrcc5 UTSW 1 72343030 missense possibly damaging 0.82
R7046:Xrcc5 UTSW 1 72394716 missense probably benign 0.00
R7446:Xrcc5 UTSW 1 72393973 splice site probably null
R7473:Xrcc5 UTSW 1 72312589 missense probably damaging 1.00
R7875:Xrcc5 UTSW 1 72329931 missense probably damaging 1.00
R7889:Xrcc5 UTSW 1 72356826 missense probably benign 0.45
R8088:Xrcc5 UTSW 1 72312436 missense probably damaging 1.00
R8179:Xrcc5 UTSW 1 72356857 missense probably damaging 0.99
R8297:Xrcc5 UTSW 1 72325085 missense possibly damaging 0.47
R8309:Xrcc5 UTSW 1 72319127 missense possibly damaging 0.55
R8717:Xrcc5 UTSW 1 72383746 missense probably benign
R8775:Xrcc5 UTSW 1 72393930 missense probably benign 0.01
R8775-TAIL:Xrcc5 UTSW 1 72393930 missense probably benign 0.01
R8798:Xrcc5 UTSW 1 72314178 missense probably damaging 1.00
R8889:Xrcc5 UTSW 1 72343031 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGGCCAAGTACTTACACAGC -3'
(R):5'- CGTGTTTCCATACAGCAGTTGAC -3'

Sequencing Primer
(F):5'- CTTACACAGCTAGGGAATACTTTGGC -3'
(R):5'- TACAGCAGTTGACCTATGGC -3'
Posted On 2021-08-02