Incidental Mutation 'R8892:Magi3'
ID 677733
Institutional Source Beutler Lab
Gene Symbol Magi3
Ensembl Gene ENSMUSG00000052539
Gene Name membrane associated guanylate kinase, WW and PDZ domain containing 3
Synonyms 4732496O19Rik, 6530407C02Rik
MMRRC Submission 068695-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.435) question?
Stock # R8892 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 103920575-104127690 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 103958141 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 648 (G648D)
Ref Sequence ENSEMBL: ENSMUSP00000067932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064371] [ENSMUST00000121198] [ENSMUST00000122303]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000064371
AA Change: G648D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067932
Gene: ENSMUSG00000052539
AA Change: G648D

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121198
AA Change: G648D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112934
Gene: ENSMUSG00000052539
AA Change: G648D

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122303
AA Change: G648D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113713
Gene: ENSMUSG00000052539
AA Change: G648D

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.6%
Validation Efficiency 100% (76/76)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T A 7: 119,815,606 (GRCm39) L285I probably damaging Het
Abcc2 T G 19: 43,795,571 (GRCm39) S442R possibly damaging Het
Adgrl3 A T 5: 81,874,516 (GRCm39) I938F probably damaging Het
Adpgk A G 9: 59,217,623 (GRCm39) Y212C probably damaging Het
Ahcyl1 C T 3: 107,579,378 (GRCm39) D219N probably benign Het
Ap3b1 G A 13: 94,679,348 (GRCm39) V997M unknown Het
Bbs1 A C 19: 4,942,954 (GRCm39) S479A probably benign Het
Bean1 A T 8: 104,943,610 (GRCm39) D231V probably damaging Het
Cacnb1 A T 11: 97,901,192 (GRCm39) V220E probably damaging Het
Camkv C T 9: 107,823,333 (GRCm39) R120* probably null Het
Ccny T G 18: 9,345,235 (GRCm39) S180R probably damaging Het
Cdh23 G T 10: 60,143,284 (GRCm39) H3012Q probably damaging Het
Chd9 A G 8: 91,660,468 (GRCm39) N476S unknown Het
Clasp2 T A 9: 113,709,251 (GRCm39) L680Q probably damaging Het
Clip1 A T 5: 123,717,565 (GRCm39) S1241R probably benign Het
Cramp1 C T 17: 25,202,114 (GRCm39) G456D probably damaging Het
Csmd3 T A 15: 47,604,634 (GRCm39) K1036N Het
Ctnna1 G A 18: 35,372,586 (GRCm39) V514I possibly damaging Het
Ddr1 A C 17: 35,993,556 (GRCm39) I852S probably benign Het
Dhrs1 G A 14: 55,977,404 (GRCm39) A238V possibly damaging Het
Echs1 A C 7: 139,688,031 (GRCm39) L258R probably damaging Het
Epha8 G T 4: 136,661,850 (GRCm39) H582N probably benign Het
Fhod3 G A 18: 25,189,452 (GRCm39) probably null Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,450 (GRCm39) probably benign Het
Gpr179 T C 11: 97,226,590 (GRCm39) D1855G possibly damaging Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Ipo9 T C 1: 135,314,544 (GRCm39) N904S possibly damaging Het
Itih3 A G 14: 30,637,635 (GRCm39) V508A probably benign Het
Klhl14 T G 18: 21,691,220 (GRCm39) T437P possibly damaging Het
Krt5 T C 15: 101,619,185 (GRCm39) M268V probably benign Het
Lama4 T A 10: 38,973,194 (GRCm39) L1587Q probably damaging Het
Lhx4 T C 1: 155,581,013 (GRCm39) T171A possibly damaging Het
Lrfn2 A C 17: 49,377,376 (GRCm39) E152D probably damaging Het
Ltn1 A T 16: 87,229,230 (GRCm39) probably benign Het
Ly9 A T 1: 171,421,465 (GRCm39) D595E possibly damaging Het
Macf1 A G 4: 123,249,036 (GRCm39) L7165P probably damaging Het
Mgll T A 6: 88,743,306 (GRCm39) C109S unknown Het
Micall2 T A 5: 139,703,254 (GRCm39) H194L probably damaging Het
Mindy4 T C 6: 55,255,223 (GRCm39) L567P probably benign Het
Mmp16 T A 4: 18,051,820 (GRCm39) Y270N probably damaging Het
Naa16 A T 14: 79,628,016 (GRCm39) F14I probably benign Het
Nme6 T G 9: 109,668,706 (GRCm39) F41V probably damaging Het
Npffr1 A G 10: 61,449,939 (GRCm39) N71S possibly damaging Het
Or1b1 C A 2: 36,995,523 (GRCm39) L46F probably damaging Het
Or1p4-ps1 T C 11: 74,207,949 (GRCm39) W33R probably damaging Het
Or4k41 A G 2: 111,279,967 (GRCm39) I161V probably benign Het
Pard3b T A 1: 62,677,026 (GRCm39) Y1186N probably damaging Het
Pou2f1 A T 1: 165,708,027 (GRCm39) S552T unknown Het
Ppp2r3c A T 12: 55,336,453 (GRCm39) L233Q possibly damaging Het
Prl8a1 G A 13: 27,766,069 (GRCm39) H9Y possibly damaging Het
Rnf135 C T 11: 80,074,957 (GRCm39) T72I probably benign Het
Rsf1 A T 7: 97,328,171 (GRCm39) I1058F Het
Slc39a6 A T 18: 24,729,386 (GRCm39) Y442* probably null Het
Slc44a2 G A 9: 21,253,153 (GRCm39) probably benign Het
Slc4a11 T G 2: 130,529,140 (GRCm39) S437R probably damaging Het
Spc24 G A 9: 21,668,994 (GRCm39) Q98* probably null Het
Spock3 T A 8: 63,404,986 (GRCm39) Y51* probably null Het
Sptbn1 A G 11: 30,067,800 (GRCm39) Y1805H probably benign Het
Tango6 A G 8: 107,468,845 (GRCm39) I780M probably benign Het
Tcerg1l C T 7: 137,999,260 (GRCm39) W41* probably null Het
Tdrd9 A G 12: 111,979,718 (GRCm39) Y401C probably benign Het
Tex47 A T 5: 7,355,115 (GRCm39) I99F probably damaging Het
Tlr9 G A 9: 106,099,834 (GRCm39) probably benign Het
Tmem209 T A 6: 30,497,942 (GRCm39) S276C possibly damaging Het
Tmprss11f A C 5: 86,687,618 (GRCm39) S97A possibly damaging Het
Top6bl A G 19: 4,699,721 (GRCm39) V494A possibly damaging Het
Ttc7 T A 17: 87,637,520 (GRCm39) M425K probably damaging Het
Ttn C T 2: 76,739,466 (GRCm39) G3737D unknown Het
Tyk2 T C 9: 21,027,463 (GRCm39) H503R probably benign Het
Unc13b A T 4: 43,176,484 (GRCm39) R2437S unknown Het
Uqcrc1 C T 9: 108,766,186 (GRCm39) R58C probably damaging Het
Vmn1r160 G A 7: 22,571,474 (GRCm39) V276I probably benign Het
Vmn2r112 A G 17: 22,837,612 (GRCm39) Y691C probably damaging Het
Vmn2r87 A C 10: 130,308,105 (GRCm39) I711S probably damaging Het
Vmn2r94 A G 17: 18,464,335 (GRCm39) S652P possibly damaging Het
Vps50 T A 6: 3,536,967 (GRCm39) C313S probably damaging Het
Xrcc5 T G 1: 72,382,190 (GRCm39) D455E possibly damaging Het
Zdhhc6 T A 19: 55,290,987 (GRCm39) probably benign Het
Zfp964 G A 8: 70,116,405 (GRCm39) G335D probably damaging Het
Other mutations in Magi3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Magi3 APN 3 103,922,294 (GRCm39) missense probably damaging 1.00
IGL00933:Magi3 APN 3 103,923,163 (GRCm39) missense probably benign
IGL01151:Magi3 APN 3 103,958,690 (GRCm39) missense probably damaging 1.00
IGL01674:Magi3 APN 3 104,013,037 (GRCm39) splice site probably benign
IGL01790:Magi3 APN 3 103,992,560 (GRCm39) missense probably damaging 1.00
IGL01903:Magi3 APN 3 103,958,526 (GRCm39) missense possibly damaging 0.87
IGL01939:Magi3 APN 3 103,961,778 (GRCm39) missense probably damaging 0.99
IGL02142:Magi3 APN 3 103,923,219 (GRCm39) missense probably benign 0.32
IGL02183:Magi3 APN 3 103,992,663 (GRCm39) missense probably benign 0.01
IGL02887:Magi3 APN 3 104,002,473 (GRCm39) missense probably damaging 1.00
IGL03071:Magi3 APN 3 103,923,202 (GRCm39) missense possibly damaging 0.51
IGL03085:Magi3 APN 3 103,922,655 (GRCm39) missense possibly damaging 0.88
IGL03192:Magi3 APN 3 103,950,562 (GRCm39) missense probably damaging 1.00
IGL03204:Magi3 APN 3 104,013,151 (GRCm39) missense probably damaging 1.00
IGL03227:Magi3 APN 3 103,958,435 (GRCm39) missense probably benign
IGL03388:Magi3 APN 3 103,923,157 (GRCm39) missense probably benign 0.30
PIT4280001:Magi3 UTSW 3 103,961,668 (GRCm39) missense probably damaging 1.00
PIT4504001:Magi3 UTSW 3 103,922,842 (GRCm39) missense probably benign 0.05
R0092:Magi3 UTSW 3 103,958,280 (GRCm39) nonsense probably null
R0514:Magi3 UTSW 3 103,922,338 (GRCm39) missense probably damaging 1.00
R0569:Magi3 UTSW 3 103,923,358 (GRCm39) missense probably benign 0.43
R0608:Magi3 UTSW 3 103,924,873 (GRCm39) missense probably damaging 1.00
R0920:Magi3 UTSW 3 103,941,507 (GRCm39) splice site probably null
R1173:Magi3 UTSW 3 103,968,946 (GRCm39) critical splice donor site probably null
R1256:Magi3 UTSW 3 103,935,126 (GRCm39) missense probably benign 0.08
R1391:Magi3 UTSW 3 103,922,374 (GRCm39) nonsense probably null
R1559:Magi3 UTSW 3 103,954,169 (GRCm39) splice site probably benign
R1568:Magi3 UTSW 3 103,996,843 (GRCm39) missense probably benign 0.02
R1631:Magi3 UTSW 3 103,958,493 (GRCm39) missense probably benign 0.05
R1747:Magi3 UTSW 3 103,941,489 (GRCm39) missense possibly damaging 0.82
R1930:Magi3 UTSW 3 103,996,920 (GRCm39) missense probably damaging 1.00
R1964:Magi3 UTSW 3 103,927,718 (GRCm39) missense probably damaging 0.99
R2151:Magi3 UTSW 3 103,992,554 (GRCm39) missense probably damaging 1.00
R2151:Magi3 UTSW 3 103,954,198 (GRCm39) missense probably damaging 1.00
R2266:Magi3 UTSW 3 103,928,382 (GRCm39) intron probably benign
R2267:Magi3 UTSW 3 103,928,382 (GRCm39) intron probably benign
R2268:Magi3 UTSW 3 103,928,382 (GRCm39) intron probably benign
R2519:Magi3 UTSW 3 103,923,081 (GRCm39) missense probably benign 0.00
R3104:Magi3 UTSW 3 103,958,636 (GRCm39) missense probably damaging 0.99
R3105:Magi3 UTSW 3 103,958,636 (GRCm39) missense probably damaging 0.99
R3619:Magi3 UTSW 3 103,961,721 (GRCm39) missense probably damaging 1.00
R4158:Magi3 UTSW 3 103,958,277 (GRCm39) missense probably damaging 1.00
R4160:Magi3 UTSW 3 103,958,277 (GRCm39) missense probably damaging 1.00
R4284:Magi3 UTSW 3 103,923,184 (GRCm39) nonsense probably null
R4285:Magi3 UTSW 3 103,923,184 (GRCm39) nonsense probably null
R4397:Magi3 UTSW 3 104,127,030 (GRCm39) missense probably damaging 1.00
R4512:Magi3 UTSW 3 103,996,871 (GRCm39) missense probably damaging 0.99
R4676:Magi3 UTSW 3 103,923,141 (GRCm39) missense probably benign
R4758:Magi3 UTSW 3 103,922,637 (GRCm39) missense probably benign 0.01
R4940:Magi3 UTSW 3 103,958,708 (GRCm39) missense probably damaging 1.00
R5039:Magi3 UTSW 3 104,013,107 (GRCm39) missense probably damaging 1.00
R5160:Magi3 UTSW 3 103,935,224 (GRCm39) missense possibly damaging 0.46
R5422:Magi3 UTSW 3 103,958,684 (GRCm39) missense probably damaging 1.00
R5509:Magi3 UTSW 3 103,922,818 (GRCm39) missense probably benign 0.00
R5839:Magi3 UTSW 3 104,127,047 (GRCm39) missense probably damaging 1.00
R5924:Magi3 UTSW 3 103,961,854 (GRCm39) splice site probably null
R6018:Magi3 UTSW 3 104,013,128 (GRCm39) missense probably damaging 1.00
R6189:Magi3 UTSW 3 103,958,181 (GRCm39) missense probably damaging 1.00
R6235:Magi3 UTSW 3 103,923,384 (GRCm39) missense probably damaging 0.99
R6244:Magi3 UTSW 3 103,923,013 (GRCm39) missense probably benign 0.16
R6258:Magi3 UTSW 3 103,996,912 (GRCm39) missense probably damaging 1.00
R6358:Magi3 UTSW 3 103,958,268 (GRCm39) missense probably damaging 1.00
R6534:Magi3 UTSW 3 103,992,536 (GRCm39) missense possibly damaging 0.75
R6806:Magi3 UTSW 3 103,954,285 (GRCm39) missense possibly damaging 0.94
R6816:Magi3 UTSW 3 103,997,227 (GRCm39) splice site probably null
R6897:Magi3 UTSW 3 103,996,873 (GRCm39) missense probably damaging 1.00
R7011:Magi3 UTSW 3 104,013,070 (GRCm39) missense probably damaging 1.00
R7039:Magi3 UTSW 3 103,958,699 (GRCm39) missense probably damaging 1.00
R7196:Magi3 UTSW 3 103,956,484 (GRCm39) missense probably benign 0.01
R7237:Magi3 UTSW 3 103,935,227 (GRCm39) missense probably damaging 1.00
R7285:Magi3 UTSW 3 103,941,430 (GRCm39) missense probably benign 0.00
R7709:Magi3 UTSW 3 103,941,354 (GRCm39) missense probably damaging 1.00
R7724:Magi3 UTSW 3 103,923,243 (GRCm39) missense probably benign 0.04
R7797:Magi3 UTSW 3 103,958,618 (GRCm39) missense probably damaging 1.00
R7950:Magi3 UTSW 3 103,924,005 (GRCm39) missense probably damaging 1.00
R8140:Magi3 UTSW 3 103,941,402 (GRCm39) missense probably damaging 1.00
R8204:Magi3 UTSW 3 103,958,502 (GRCm39) missense probably benign
R8229:Magi3 UTSW 3 103,923,018 (GRCm39) missense probably benign 0.00
R8229:Magi3 UTSW 3 103,923,017 (GRCm39) missense possibly damaging 0.79
R8260:Magi3 UTSW 3 103,922,625 (GRCm39) missense probably benign 0.01
R8348:Magi3 UTSW 3 103,958,531 (GRCm39) missense probably damaging 1.00
R8368:Magi3 UTSW 3 104,002,379 (GRCm39) critical splice donor site probably null
R8543:Magi3 UTSW 3 104,126,984 (GRCm39) missense probably damaging 0.98
R8762:Magi3 UTSW 3 103,958,169 (GRCm39) missense probably damaging 1.00
R8826:Magi3 UTSW 3 103,992,662 (GRCm39) missense probably benign 0.00
R8847:Magi3 UTSW 3 103,922,334 (GRCm39) missense probably benign 0.09
R8939:Magi3 UTSW 3 103,996,748 (GRCm39) intron probably benign
R9090:Magi3 UTSW 3 103,923,264 (GRCm39) missense possibly damaging 0.68
R9187:Magi3 UTSW 3 103,923,073 (GRCm39) missense possibly damaging 0.76
R9271:Magi3 UTSW 3 103,923,264 (GRCm39) missense possibly damaging 0.68
R9433:Magi3 UTSW 3 103,922,473 (GRCm39) missense probably benign 0.01
R9439:Magi3 UTSW 3 103,922,473 (GRCm39) missense probably benign 0.01
R9557:Magi3 UTSW 3 103,924,933 (GRCm39) missense probably damaging 1.00
R9557:Magi3 UTSW 3 103,922,473 (GRCm39) missense probably benign 0.01
R9697:Magi3 UTSW 3 103,956,458 (GRCm39) critical splice donor site probably null
R9796:Magi3 UTSW 3 103,928,291 (GRCm39) missense probably benign
X0026:Magi3 UTSW 3 103,927,736 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCATAATGGACATGAATGAAACCACC -3'
(R):5'- TCTGATTAAGGGCCCCAAAGG -3'

Sequencing Primer
(F):5'- TGGACATGAATGAAACCACCAATAAC -3'
(R):5'- CAAAGGCTTTGGGTTTGCAATTGC -3'
Posted On 2021-08-02