Mutagenetix > Incidental Mutation

Incidental Mutation 'R8892:Clip1'

677742

Institutional Source

Beutler Lab

Gene Symbol

Clip1

Ensembl Gene

ENSMUSG00000049550

Gene Name

CAP-GLY domain containing linker protein 1

Synonyms

Clip50, 4631429H07Rik, CLIP-170, restin, Rsn, Clip 170, 1110007I12Rik, cytoplasmic linker protein 50

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8892 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

123577795-123684618 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 123579502 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 1241 (S1241R)

Ref Sequence

ENSEMBL: ENSMUSP00000107190 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031382] [ENSMUST00000063905] [ENSMUST00000111561] [ENSMUST00000111564] [ENSMUST00000111566]

AlphaFold

Q922J3

PDB Structure

Solution structure of the 1st CAP-Gly domain in mouse CLIP-170/restin [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000031382
AA Change: S1363R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000031382
Gene: ENSMUSG00000049550
AA Change: S1363R

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	2.28e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	2.28e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	451	N/A	INTRINSIC
coiled coil region	474	535	N/A	INTRINSIC
coiled coil region	581	620	N/A	INTRINSIC
coiled coil region	652	1352	N/A	INTRINSIC
low complexity region	1362	1373	N/A	INTRINSIC
Pfam:CLIP1_ZNF	1375	1392	5.8e-9	PFAM
ZnF_C2HC	1417	1433	1.45e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000063905
AA Change: S1246R

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000068241
Gene: ENSMUSG00000049550
AA Change: S1246R

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	3.3e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	3.3e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	524	N/A	INTRINSIC
coiled coil region	570	609	N/A	INTRINSIC
coiled coil region	641	1075	N/A	INTRINSIC
coiled coil region	1115	1235	N/A	INTRINSIC
low complexity region	1245	1256	N/A	INTRINSIC
ZnF_C2HC	1300	1316	1.45e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111561
AA Change: S1352R

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000107186
Gene: ENSMUSG00000049550
AA Change: S1352R

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	1.93e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	1.93e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	524	N/A	INTRINSIC
coiled coil region	570	609	N/A	INTRINSIC
coiled coil region	641	1341	N/A	INTRINSIC
low complexity region	1351	1362	N/A	INTRINSIC
ZnF_C2HC	1406	1422	1.45e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111564
AA Change: S1241R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000107190
Gene: ENSMUSG00000049550
AA Change: S1241R

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	2.5e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	2.5e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	489	N/A	INTRINSIC
coiled coil region	535	574	N/A	INTRINSIC
coiled coil region	606	1230	N/A	INTRINSIC
low complexity region	1240	1251	N/A	INTRINSIC
ZnF_C2HC	1295	1311	1.45e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111566
AA Change: S1317R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000107192
Gene: ENSMUSG00000049550
AA Change: S1317R

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	2e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	2e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	489	N/A	INTRINSIC
coiled coil region	535	574	N/A	INTRINSIC
coiled coil region	606	1306	N/A	INTRINSIC
low complexity region	1316	1327	N/A	INTRINSIC
ZnF_C2HC	1371	1387	1.45e0	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000121425
Gene: ENSMUSG00000049550
AA Change: S991R

Domain	Start	End	E-Value	Type
CAP_GLY	2	31	2.59e0	SMART
low complexity region	39	57	N/A	INTRINSIC
low complexity region	58	84	N/A	INTRINSIC
coiled coil region	101	276	N/A	INTRINSIC
coiled coil region	322	361	N/A	INTRINSIC
coiled coil region	393	980	N/A	INTRINSIC
low complexity region	991	1002	N/A	INTRINSIC
Pfam:CLIP1_ZNF	1004	1021	4.2e-9	PFAM
ZnF_C2HC	1046	1062	1.45e0	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000122064
Gene: ENSMUSG00000049550
AA Change: S1164R

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
low complexity region	165	176	N/A	INTRINSIC
internal_repeat_1	352	375	1.56e-8	PROSPERO
internal_repeat_3	358	377	5.32e-6	PROSPERO
internal_repeat_1	450	473	1.56e-8	PROSPERO
internal_repeat_3	544	563	5.32e-6	PROSPERO
internal_repeat_2	553	575	2.88e-7	PROSPERO
low complexity region	735	744	N/A	INTRINSIC
internal_repeat_2	781	803	2.88e-7	PROSPERO
low complexity region	819	830	N/A	INTRINSIC
low complexity region	962	977	N/A	INTRINSIC
low complexity region	1081	1099	N/A	INTRINSIC
low complexity region	1110	1121	N/A	INTRINSIC
low complexity region	1164	1175	N/A	INTRINSIC

Meta Mutation Damage Score

0.1328

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.6%

Validation Efficiency

100% (76/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene links endocytic vesicles to microtubules. This gene is highly expressed in Reed-Sternberg cells of Hodgkin disease. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted allele display reduced male fertility and teratozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	T	A	7: 120,216,383	L285I	probably damaging	Het
Abcc2	T	G	19: 43,807,132	S442R	possibly damaging	Het
Adgrl3	A	T	5: 81,726,669	I938F	probably damaging	Het
Adpgk	A	G	9: 59,310,340	Y212C	probably damaging	Het
Ahcyl1	C	T	3: 107,672,062	D219N	probably benign	Het
Ap3b1	G	A	13: 94,542,840	V997M	unknown	Het
Bbs1	A	C	19: 4,892,926	S479A	probably benign	Het
Bean1	A	T	8: 104,216,978	D231V	probably damaging	Het
Cacnb1	A	T	11: 98,010,366	V220E	probably damaging	Het
Camkv	C	T	9: 107,946,134	R120*	probably null	Het
Ccny	T	G	18: 9,345,235	S180R	probably damaging	Het
Cdh23	G	T	10: 60,307,505	H3012Q	probably damaging	Het
Chd9	A	G	8: 90,933,840	N476S	unknown	Het
Clasp2	T	A	9: 113,880,183	L680Q	probably damaging	Het
Cramp1l	C	T	17: 24,983,140	G456D	probably damaging	Het
Csmd3	T	A	15: 47,741,238	K1036N		Het
Ctnna1	G	A	18: 35,239,533	V514I	possibly damaging	Het
Ddr1	A	C	17: 35,682,664	I852S	probably benign	Het
Dhrs1	G	A	14: 55,739,947	A238V	possibly damaging	Het
Echs1	A	C	7: 140,108,118	L258R	probably damaging	Het
Epha8	G	T	4: 136,934,539	H582N	probably benign	Het
Fhod3	G	A	18: 25,056,395		probably null	Het
Gm40460	ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	7: 142,240,713		probably benign	Het
Gm960	A	G	19: 4,649,693	V494A	possibly damaging	Het
Gpr179	T	C	11: 97,335,764	D1855G	possibly damaging	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Ipo9	T	C	1: 135,386,806	N904S	possibly damaging	Het
Itih3	A	G	14: 30,915,678	V508A	probably benign	Het
Klhl14	T	G	18: 21,558,163	T437P	possibly damaging	Het
Krt5	T	C	15: 101,710,750	M268V	probably benign	Het
Lama4	T	A	10: 39,097,198	L1587Q	probably damaging	Het
Lhx4	T	C	1: 155,705,267	T171A	possibly damaging	Het
Lrfn2	A	C	17: 49,070,348	E152D	probably damaging	Het
Ltn1	A	T	16: 87,432,342		probably benign	Het
Ly9	A	T	1: 171,593,897	D595E	possibly damaging	Het
Macf1	A	G	4: 123,355,243	L7165P	probably damaging	Het
Magi3	C	T	3: 104,050,825	G648D	probably damaging	Het
Mgll	T	A	6: 88,766,324	C109S	unknown	Het
Micall2	T	A	5: 139,717,499	H194L	probably damaging	Het
Mindy4	T	C	6: 55,278,238	L567P	probably benign	Het
Mmp16	T	A	4: 18,051,820	Y270N	probably damaging	Het
Naa16	A	T	14: 79,390,576	F14I	probably benign	Het
Nme6	T	G	9: 109,839,638	F41V	probably damaging	Het
Npffr1	A	G	10: 61,614,160	N71S	possibly damaging	Het
Olfr1287	A	G	2: 111,449,622	I161V	probably benign	Het
Olfr362	C	A	2: 37,105,511	L46F	probably damaging	Het
Olfr409-ps1	T	C	11: 74,317,123	W33R	probably damaging	Het
Pard3b	T	A	1: 62,637,867	Y1186N	probably damaging	Het
Pou2f1	A	T	1: 165,880,458	S552T	unknown	Het
Ppp2r3c	A	T	12: 55,289,668	L233Q	possibly damaging	Het
Prl8a1	G	A	13: 27,582,086	H9Y	possibly damaging	Het
Rnf135	C	T	11: 80,184,131	T72I	probably benign	Het
Rsf1	A	T	7: 97,678,964	I1058F		Het
Slc39a6	A	T	18: 24,596,329	Y442*	probably null	Het
Slc44a2	G	A	9: 21,341,857		probably benign	Het
Slc4a11	T	G	2: 130,687,220	S437R	probably damaging	Het
Spc24	G	A	9: 21,757,698	Q98*	probably null	Het
Spock3	T	A	8: 62,951,952	Y51*	probably null	Het
Sptbn1	A	G	11: 30,117,800	Y1805H	probably benign	Het
Tango6	A	G	8: 106,742,213	I780M	probably benign	Het
Tcerg1l	C	T	7: 138,397,531	W41*	probably null	Het
Tdrd9	A	G	12: 112,013,284	Y401C	probably benign	Het
Tex47	A	T	5: 7,305,115	I99F	probably damaging	Het
Tlr9	G	A	9: 106,222,635		probably benign	Het
Tmem209	T	A	6: 30,497,943	S276C	possibly damaging	Het
Tmprss11f	A	C	5: 86,539,759	S97A	possibly damaging	Het
Ttc7	T	A	17: 87,330,092	M425K	probably damaging	Het
Ttn	C	T	2: 76,909,122	G3737D	unknown	Het
Tyk2	T	C	9: 21,116,167	H503R	probably benign	Het
Unc13b	A	T	4: 43,176,484	R2437S	unknown	Het
Uqcrc1	C	T	9: 108,937,118	R58C	probably damaging	Het
Vmn1r160	G	A	7: 22,872,049	V276I	probably benign	Het
Vmn2r112	A	G	17: 22,618,631	Y691C	probably damaging	Het
Vmn2r87	A	C	10: 130,472,236	I711S	probably damaging	Het
Vmn2r94	A	G	17: 18,244,073	S652P	possibly damaging	Het
Vps50	T	A	6: 3,536,967	C313S	probably damaging	Het
Xrcc5	T	G	1: 72,343,031	D455E	possibly damaging	Het
Zdhhc6	T	A	19: 55,302,555		probably benign	Het
Zfp964	G	A	8: 69,663,755	G335D	probably damaging	Het

Other mutations in Clip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Clip1	APN	5	123603654	missense	possibly damaging	0.94
IGL01067:Clip1	APN	5	123630804	missense	probably damaging	0.99
IGL01524:Clip1	APN	5	123579379	missense	probably damaging	1.00
IGL01632:Clip1	APN	5	123617496	missense	probably damaging	1.00
IGL01798:Clip1	APN	5	123583549	missense	probably damaging	1.00
IGL01874:Clip1	APN	5	123603666	missense	possibly damaging	0.50
IGL01908:Clip1	APN	5	123623207	splice site	probably benign
IGL02120:Clip1	APN	5	123647883	missense	probably damaging	1.00
IGL02309:Clip1	APN	5	123617700	missense	probably damaging	0.99
IGL02555:Clip1	APN	5	123621794	critical splice donor site	probably null
IGL03027:Clip1	APN	5	123621856	missense	probably benign	0.43
IGL03336:Clip1	APN	5	123653570	nonsense	probably null
IGL03365:Clip1	APN	5	123583586	missense	probably damaging	1.00
IGL02802:Clip1	UTSW	5	123631123	missense	probably damaging	1.00
PIT4812001:Clip1	UTSW	5	123630675	missense	probably benign	0.08
R0254:Clip1	UTSW	5	123617332	splice site	probably benign
R0401:Clip1	UTSW	5	123653789	missense	probably damaging	1.00
R0530:Clip1	UTSW	5	123640531	missense	probably damaging	1.00
R0744:Clip1	UTSW	5	123630721	missense	probably benign	0.05
R0833:Clip1	UTSW	5	123630721	missense	probably benign	0.05
R1116:Clip1	UTSW	5	123579491	missense	probably damaging	0.99
R1182:Clip1	UTSW	5	123647865	missense	probably damaging	1.00
R1656:Clip1	UTSW	5	123630403	missense	possibly damaging	0.61
R1700:Clip1	UTSW	5	123630370	missense	probably benign
R1889:Clip1	UTSW	5	123653496	missense	probably damaging	0.99
R1975:Clip1	UTSW	5	123623218	missense	possibly damaging	0.79
R2406:Clip1	UTSW	5	123603660	missense	probably damaging	1.00
R3545:Clip1	UTSW	5	123631078	missense	probably damaging	1.00
R3547:Clip1	UTSW	5	123631078	missense	probably damaging	1.00
R3548:Clip1	UTSW	5	123631078	missense	probably damaging	1.00
R3911:Clip1	UTSW	5	123590834	missense	probably damaging	1.00
R3944:Clip1	UTSW	5	123617829	unclassified	probably benign
R4660:Clip1	UTSW	5	123579374	missense	probably damaging	0.98
R4784:Clip1	UTSW	5	123579293	missense	probably damaging	1.00
R4785:Clip1	UTSW	5	123579293	missense	probably damaging	1.00
R4824:Clip1	UTSW	5	123631023	missense	probably damaging	1.00
R4831:Clip1	UTSW	5	123583601	missense	probably damaging	1.00
R4951:Clip1	UTSW	5	123630345	missense	probably benign	0.02
R4960:Clip1	UTSW	5	123654003	nonsense	probably null
R5014:Clip1	UTSW	5	123617730	missense	probably damaging	0.99
R5116:Clip1	UTSW	5	123630707	missense	probably benign	0.05
R5212:Clip1	UTSW	5	123630681	missense	probably benign	0.09
R5238:Clip1	UTSW	5	123647883	missense	probably damaging	1.00
R5318:Clip1	UTSW	5	123613084	unclassified	probably benign
R5372:Clip1	UTSW	5	123630240	missense	probably benign	0.02
R5701:Clip1	UTSW	5	123613303	unclassified	probably benign
R5734:Clip1	UTSW	5	123615154	unclassified	probably benign
R5757:Clip1	UTSW	5	123627397	missense	probably benign	0.21
R6024:Clip1	UTSW	5	123615089	missense	possibly damaging	0.66
R6160:Clip1	UTSW	5	123613541	missense	possibly damaging	0.66
R6177:Clip1	UTSW	5	123613834	unclassified	probably benign
R6183:Clip1	UTSW	5	123642604	missense	probably damaging	1.00
R6377:Clip1	UTSW	5	123603654	missense	possibly damaging	0.50
R6436:Clip1	UTSW	5	123641785	missense	probably damaging	1.00
R6471:Clip1	UTSW	5	123640549	missense	probably damaging	0.99
R6766:Clip1	UTSW	5	123614764	unclassified	probably benign
R7015:Clip1	UTSW	5	123613612	unclassified	probably benign
R7094:Clip1	UTSW	5	123623270	missense	probably benign	0.02
R7143:Clip1	UTSW	5	123653610	missense	probably benign
R7222:Clip1	UTSW	5	123611841	missense	probably damaging	0.99
R7233:Clip1	UTSW	5	123611859	missense	probably damaging	1.00
R7238:Clip1	UTSW	5	123613265	missense
R7249:Clip1	UTSW	5	123603600	missense	probably damaging	1.00
R7283:Clip1	UTSW	5	123613794	missense
R7295:Clip1	UTSW	5	123627356	missense	probably benign	0.19
R7447:Clip1	UTSW	5	123653633	missense	probably benign	0.03
R7458:Clip1	UTSW	5	123640546	missense	probably damaging	1.00
R7483:Clip1	UTSW	5	123617384	missense	probably benign	0.00
R7516:Clip1	UTSW	5	123583385	missense	probably benign	0.00
R7619:Clip1	UTSW	5	123614279	missense
R7831:Clip1	UTSW	5	123613279	missense
R7897:Clip1	UTSW	5	123622798	missense	probably benign
R8155:Clip1	UTSW	5	123613636	missense
R8157:Clip1	UTSW	5	123630719	missense	probably benign	0.17
R8232:Clip1	UTSW	5	123647918	missense	probably benign	0.05
R8396:Clip1	UTSW	5	123642564	missense	probably damaging	1.00
R8446:Clip1	UTSW	5	123655945	missense	probably damaging	1.00
R8486:Clip1	UTSW	5	123614707	unclassified	probably benign
R8511:Clip1	UTSW	5	123653906	missense	possibly damaging	0.50
R8731:Clip1	UTSW	5	123614693	missense
R8889:Clip1	UTSW	5	123579502	missense	probably benign	0.00
R9058:Clip1	UTSW	5	123614582	missense
R9106:Clip1	UTSW	5	123615160	missense	probably damaging	0.97
R9212:Clip1	UTSW	5	123583336	missense	probably damaging	1.00
R9217:Clip1	UTSW	5	123579378	missense	probably damaging	1.00
R9223:Clip1	UTSW	5	123646274	missense	probably damaging	1.00
R9325:Clip1	UTSW	5	123613123	missense
R9752:Clip1	UTSW	5	123621946	missense	probably damaging	1.00
Z1177:Clip1	UTSW	5	123617350	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGATCTCACAGTATGGCCGC -3'
(R):5'- CTTTGTCAGGGCAAACCACC -3'

Sequencing Primer
(F):5'- ACAGTATGGCCGCTCCTC -3'
(R):5'- GGCATGTATATATGTGCACCAC -3'

Posted On

2021-08-02