Mutagenetix > Incidental Mutation

Incidental Mutation 'R8892:Ap3b1'

677780

Institutional Source

Beutler Lab

Gene Symbol

Ap3b1

Ensembl Gene

ENSMUSG00000021686

Gene Name

adaptor-related protein complex 3, beta 1 subunit

Synonyms

recombination induced mutation 2, rim2, Hps2, beta3A, AP-3

MMRRC Submission

Accession Numbers

Ap3b1: Ncbi RefSeq: NM_009680; MGI: 1333879;

Essential gene?

Possibly non essential (E-score: 0.408) question?

Stock #

R8892 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

94358960-94566317 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 94542840 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 997 (V997M)

Ref Sequence

ENSEMBL: ENSMUSP00000022196 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022196]

AlphaFold

Q9Z1T1

Predicted Effect

unknown
Transcript: ENSMUST00000022196
AA Change: V997M

SMART Domains

Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686
AA Change: V997M

Domain	Start	End	E-Value	Type
low complexity region	10	24	N/A	INTRINSIC
Pfam:Adaptin_N	39	586	1.2e-170	PFAM
Pfam:SEEEED	672	812	1.3e-27	PFAM
AP3B1_C	822	969	1.58e-78	SMART
Blast:B2	993	1103	2e-27	BLAST

Predicted Effect

Meta Mutation Damage Score

0.1071

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.6%

Validation Efficiency

100% (76/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]

Allele List at MGI

All alleles(53) : Targeted(4) Gene trapped(34) Spontaneous(14) Chemically induced(1)

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	T	A	7: 120,216,383	L285I	probably damaging	Het
Abcc2	T	G	19: 43,807,132	S442R	possibly damaging	Het
Adgrl3	A	T	5: 81,726,669	I938F	probably damaging	Het
Adpgk	A	G	9: 59,310,340	Y212C	probably damaging	Het
Ahcyl1	C	T	3: 107,672,062	D219N	probably benign	Het
Bbs1	A	C	19: 4,892,926	S479A	probably benign	Het
Bean1	A	T	8: 104,216,978	D231V	probably damaging	Het
Cacnb1	A	T	11: 98,010,366	V220E	probably damaging	Het
Camkv	C	T	9: 107,946,134	R120*	probably null	Het
Ccny	T	G	18: 9,345,235	S180R	probably damaging	Het
Cdh23	G	T	10: 60,307,505	H3012Q	probably damaging	Het
Chd9	A	G	8: 90,933,840	N476S	unknown	Het
Clasp2	T	A	9: 113,880,183	L680Q	probably damaging	Het
Clip1	A	T	5: 123,579,502	S1241R	probably benign	Het
Cramp1l	C	T	17: 24,983,140	G456D	probably damaging	Het
Csmd3	T	A	15: 47,741,238	K1036N		Het
Ctnna1	G	A	18: 35,239,533	V514I	possibly damaging	Het
Ddr1	A	C	17: 35,682,664	I852S	probably benign	Het
Dhrs1	G	A	14: 55,739,947	A238V	possibly damaging	Het
Echs1	A	C	7: 140,108,118	L258R	probably damaging	Het
Epha8	G	T	4: 136,934,539	H582N	probably benign	Het
Fhod3	G	A	18: 25,056,395		probably null	Het
Gm40460	ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG	7: 142,240,713		probably benign	Het
Gm960	A	G	19: 4,649,693	V494A	possibly damaging	Het
Gpr179	T	C	11: 97,335,764	D1855G	possibly damaging	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Ipo9	T	C	1: 135,386,806	N904S	possibly damaging	Het
Itih3	A	G	14: 30,915,678	V508A	probably benign	Het
Klhl14	T	G	18: 21,558,163	T437P	possibly damaging	Het
Krt5	T	C	15: 101,710,750	M268V	probably benign	Het
Lama4	T	A	10: 39,097,198	L1587Q	probably damaging	Het
Lhx4	T	C	1: 155,705,267	T171A	possibly damaging	Het
Lrfn2	A	C	17: 49,070,348	E152D	probably damaging	Het
Ltn1	A	T	16: 87,432,342		probably benign	Het
Ly9	A	T	1: 171,593,897	D595E	possibly damaging	Het
Macf1	A	G	4: 123,355,243	L7165P	probably damaging	Het
Magi3	C	T	3: 104,050,825	G648D	probably damaging	Het
Mgll	T	A	6: 88,766,324	C109S	unknown	Het
Micall2	T	A	5: 139,717,499	H194L	probably damaging	Het
Mindy4	T	C	6: 55,278,238	L567P	probably benign	Het
Mmp16	T	A	4: 18,051,820	Y270N	probably damaging	Het
Naa16	A	T	14: 79,390,576	F14I	probably benign	Het
Nme6	T	G	9: 109,839,638	F41V	probably damaging	Het
Npffr1	A	G	10: 61,614,160	N71S	possibly damaging	Het
Olfr1287	A	G	2: 111,449,622	I161V	probably benign	Het
Olfr362	C	A	2: 37,105,511	L46F	probably damaging	Het
Olfr409-ps1	T	C	11: 74,317,123	W33R	probably damaging	Het
Pard3b	T	A	1: 62,637,867	Y1186N	probably damaging	Het
Pou2f1	A	T	1: 165,880,458	S552T	unknown	Het
Ppp2r3c	A	T	12: 55,289,668	L233Q	possibly damaging	Het
Prl8a1	G	A	13: 27,582,086	H9Y	possibly damaging	Het
Rnf135	C	T	11: 80,184,131	T72I	probably benign	Het
Rsf1	A	T	7: 97,678,964	I1058F		Het
Slc39a6	A	T	18: 24,596,329	Y442*	probably null	Het
Slc44a2	G	A	9: 21,341,857		probably benign	Het
Slc4a11	T	G	2: 130,687,220	S437R	probably damaging	Het
Spc24	G	A	9: 21,757,698	Q98*	probably null	Het
Spock3	T	A	8: 62,951,952	Y51*	probably null	Het
Sptbn1	A	G	11: 30,117,800	Y1805H	probably benign	Het
Tango6	A	G	8: 106,742,213	I780M	probably benign	Het
Tcerg1l	C	T	7: 138,397,531	W41*	probably null	Het
Tdrd9	A	G	12: 112,013,284	Y401C	probably benign	Het
Tex47	A	T	5: 7,305,115	I99F	probably damaging	Het
Tlr9	G	A	9: 106,222,635		probably benign	Het
Tmem209	T	A	6: 30,497,943	S276C	possibly damaging	Het
Tmprss11f	A	C	5: 86,539,759	S97A	possibly damaging	Het
Ttc7	T	A	17: 87,330,092	M425K	probably damaging	Het
Ttn	C	T	2: 76,909,122	G3737D	unknown	Het
Tyk2	T	C	9: 21,116,167	H503R	probably benign	Het
Unc13b	A	T	4: 43,176,484	R2437S	unknown	Het
Uqcrc1	C	T	9: 108,937,118	R58C	probably damaging	Het
Vmn1r160	G	A	7: 22,872,049	V276I	probably benign	Het
Vmn2r112	A	G	17: 22,618,631	Y691C	probably damaging	Het
Vmn2r87	A	C	10: 130,472,236	I711S	probably damaging	Het
Vmn2r94	A	G	17: 18,244,073	S652P	possibly damaging	Het
Vps50	T	A	6: 3,536,967	C313S	probably damaging	Het
Xrcc5	T	G	1: 72,343,031	D455E	possibly damaging	Het
Zdhhc6	T	A	19: 55,302,555		probably benign	Het
Zfp964	G	A	8: 69,663,755	G335D	probably damaging	Het

Other mutations in Ap3b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00660:Ap3b1	APN	13	94390863	missense	probably damaging	1.00
IGL00766:Ap3b1	APN	13	94542884	splice site	probably benign
IGL01784:Ap3b1	APN	13	94493739	missense	probably damaging	1.00
IGL01979:Ap3b1	APN	13	94448463	nonsense	probably null
IGL02040:Ap3b1	APN	13	94408845	critical splice donor site	probably null
IGL02119:Ap3b1	APN	13	94462403	missense	probably benign	0.01
IGL02247:Ap3b1	APN	13	94394795	critical splice donor site	probably null
IGL02303:Ap3b1	APN	13	94528319	missense	unknown
IGL02493:Ap3b1	APN	13	94404020	missense	probably damaging	0.98
IGL02551:Ap3b1	APN	13	94418091	missense	probably damaging	0.99
IGL02651:Ap3b1	APN	13	94477021	missense	probably damaging	1.00
IGL02832:Ap3b1	APN	13	94528327	missense	unknown
IGL03033:Ap3b1	APN	13	94448495	missense	probably benign	0.15
IGL03101:Ap3b1	APN	13	94455398	missense	probably benign	0.00
bella	UTSW	13	94528257	missense	unknown
bullet_gray	UTSW	13	94451087	critical splice donor site	probably benign
cuttlefish	UTSW	13	94448451	critical splice acceptor site	probably null
Gastropod	UTSW	13	94542840	missense	unknown
razor	UTSW	13	94493731	missense	unknown
Slime	UTSW	13	94404078	missense	possibly damaging	0.51
slug	UTSW	13	94408845	critical splice donor site	probably null
snail	UTSW	13	94479885	splice site	probably benign
stalk	UTSW	13	94472931	critical splice donor site	probably null
R0034:Ap3b1	UTSW	13	94479885	splice site	probably benign
R0265:Ap3b1	UTSW	13	94493681	missense	unknown
R0270:Ap3b1	UTSW	13	94404118	splice site	probably benign
R0346:Ap3b1	UTSW	13	94445971	nonsense	probably null
R0422:Ap3b1	UTSW	13	94462460	missense	probably damaging	0.99
R0496:Ap3b1	UTSW	13	94472938	splice site	probably benign
R0508:Ap3b1	UTSW	13	94565714	missense	unknown
R0764:Ap3b1	UTSW	13	94479879	splice site	probably benign
R1506:Ap3b1	UTSW	13	94446143	splice site	probably benign
R1593:Ap3b1	UTSW	13	94501927	missense	unknown
R1660:Ap3b1	UTSW	13	94408812	missense	probably damaging	0.98
R1735:Ap3b1	UTSW	13	94493717	missense	unknown
R1791:Ap3b1	UTSW	13	94408797	missense	possibly damaging	0.63
R1818:Ap3b1	UTSW	13	94471704	missense	possibly damaging	0.48
R2280:Ap3b1	UTSW	13	94528216	missense	unknown
R3031:Ap3b1	UTSW	13	94565643	missense	unknown
R3037:Ap3b1	UTSW	13	94445978	critical splice donor site	probably null
R4401:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4402:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4403:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4532:Ap3b1	UTSW	13	94565735	missense	unknown
R4624:Ap3b1	UTSW	13	94483226	missense	unknown
R4626:Ap3b1	UTSW	13	94404078	missense	possibly damaging	0.51
R4754:Ap3b1	UTSW	13	94403960	missense	probably damaging	1.00
R4788:Ap3b1	UTSW	13	94565641	missense	unknown
R4847:Ap3b1	UTSW	13	94471779	missense	probably benign	0.15
R4886:Ap3b1	UTSW	13	94472805	missense	possibly damaging	0.50
R5096:Ap3b1	UTSW	13	94479849	missense	unknown
R5628:Ap3b1	UTSW	13	94477048	missense	unknown
R5671:Ap3b1	UTSW	13	94528257	missense	unknown
R5677:Ap3b1	UTSW	13	94528196	missense	unknown
R5862:Ap3b1	UTSW	13	94547770	missense	unknown
R5941:Ap3b1	UTSW	13	94440273	missense	probably benign	0.02
R5941:Ap3b1	UTSW	13	94483265	missense	probably damaging	0.96
R6043:Ap3b1	UTSW	13	94476993	missense	probably benign	0.09
R6212:Ap3b1	UTSW	13	94451073	missense	probably damaging	1.00
R6212:Ap3b1	UTSW	13	94493699	missense	unknown
R6301:Ap3b1	UTSW	13	94528295	missense	unknown
R6765:Ap3b1	UTSW	13	94462509	missense	probably benign	0.02
R6812:Ap3b1	UTSW	13	94479861	missense	unknown
R6888:Ap3b1	UTSW	13	94408791	missense	probably benign	0.42
R6901:Ap3b1	UTSW	13	94418142	missense	probably benign	0.00
R7157:Ap3b1	UTSW	13	94532034	nonsense	probably null
R7422:Ap3b1	UTSW	13	94528165	missense	unknown
R7642:Ap3b1	UTSW	13	94477032	missense	probably benign	0.19
R7710:Ap3b1	UTSW	13	94451073	missense	probably damaging	1.00
R7757:Ap3b1	UTSW	13	94528158	splice site	probably null
R7867:Ap3b1	UTSW	13	94483263	missense	unknown
R8492:Ap3b1	UTSW	13	94394786	missense	possibly damaging	0.60
R8706:Ap3b1	UTSW	13	94408845	critical splice donor site	probably null
R8749:Ap3b1	UTSW	13	94528217	missense	unknown
R8876:Ap3b1	UTSW	13	94404078	missense	possibly damaging	0.51
R8889:Ap3b1	UTSW	13	94542840	missense	unknown
R9065:Ap3b1	UTSW	13	94471715	missense	probably damaging	1.00
R9152:Ap3b1	UTSW	13	94493731	missense	unknown
R9152:Ap3b1	UTSW	13	94472931	critical splice donor site	probably null
R9166:Ap3b1	UTSW	13	94471728	missense	probably damaging	1.00
R9218:Ap3b1	UTSW	13	94448451	critical splice acceptor site	probably null
R9269:Ap3b1	UTSW	13	94404062	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTGCCTCACAGACGGAAACC -3'
(R):5'- TATGAGGGCACGCACTAGAG -3'

Sequencing Primer
(F):5'- GAAACCCTCGGGCTCTTACAG -3'
(R):5'- CACGCACTAGAGAAAATGGGC -3'

Posted On

2021-08-02