Incidental Mutation 'R8892:Naa16'
ID 677783
Institutional Source Beutler Lab
Gene Symbol Naa16
Ensembl Gene ENSMUSG00000022020
Gene Name N(alpha)-acetyltransferase 16, NatA auxiliary subunit
Synonyms Narg1l, 1300019C06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock # R8892 (G1)
Quality Score 135.008
Status Validated
Chromosome 14
Chromosomal Location 79325269-79390778 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 79390576 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 14 (F14I)
Ref Sequence ENSEMBL: ENSMUSP00000022597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022597] [ENSMUST00000163486] [ENSMUST00000169500]
AlphaFold Q9DBB4
Predicted Effect probably benign
Transcript: ENSMUST00000022597
AA Change: F14I

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000022597
Gene: ENSMUSG00000022020
AA Change: F14I

DomainStartEndE-ValueType
TPR 46 79 2.99e1 SMART
TPR 80 113 2.98e-3 SMART
Blast:TPR 224 257 1e-10 BLAST
TPR 374 407 9.96e0 SMART
TPR 408 441 7.47e0 SMART
low complexity region 616 633 N/A INTRINSIC
Blast:TPR 672 705 3e-12 BLAST
low complexity region 830 841 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163486
SMART Domains Protein: ENSMUSP00000131268
Gene: ENSMUSG00000022020

DomainStartEndE-ValueType
TPR 12 45 2.99e1 SMART
TPR 46 79 2.98e-3 SMART
Blast:TPR 190 223 3e-10 BLAST
TPR 340 373 9.96e0 SMART
TPR 374 407 7.47e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169500
AA Change: F14I

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127298
Gene: ENSMUSG00000022020
AA Change: F14I

DomainStartEndE-ValueType
PDB:4KVO|D 1 46 1e-6 PDB
Meta Mutation Damage Score 0.4929 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.6%
Validation Efficiency 100% (76/76)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T A 7: 120,216,383 L285I probably damaging Het
Abcc2 T G 19: 43,807,132 S442R possibly damaging Het
Adgrl3 A T 5: 81,726,669 I938F probably damaging Het
Adpgk A G 9: 59,310,340 Y212C probably damaging Het
Ahcyl1 C T 3: 107,672,062 D219N probably benign Het
Ap3b1 G A 13: 94,542,840 V997M unknown Het
Bbs1 A C 19: 4,892,926 S479A probably benign Het
Bean1 A T 8: 104,216,978 D231V probably damaging Het
Cacnb1 A T 11: 98,010,366 V220E probably damaging Het
Camkv C T 9: 107,946,134 R120* probably null Het
Ccny T G 18: 9,345,235 S180R probably damaging Het
Cdh23 G T 10: 60,307,505 H3012Q probably damaging Het
Chd9 A G 8: 90,933,840 N476S unknown Het
Clasp2 T A 9: 113,880,183 L680Q probably damaging Het
Clip1 A T 5: 123,579,502 S1241R probably benign Het
Cramp1l C T 17: 24,983,140 G456D probably damaging Het
Csmd3 T A 15: 47,741,238 K1036N Het
Ctnna1 G A 18: 35,239,533 V514I possibly damaging Het
Ddr1 A C 17: 35,682,664 I852S probably benign Het
Dhrs1 G A 14: 55,739,947 A238V possibly damaging Het
Echs1 A C 7: 140,108,118 L258R probably damaging Het
Epha8 G T 4: 136,934,539 H582N probably benign Het
Fhod3 G A 18: 25,056,395 probably null Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,713 probably benign Het
Gm960 A G 19: 4,649,693 V494A possibly damaging Het
Gpr179 T C 11: 97,335,764 D1855G possibly damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Ipo9 T C 1: 135,386,806 N904S possibly damaging Het
Itih3 A G 14: 30,915,678 V508A probably benign Het
Klhl14 T G 18: 21,558,163 T437P possibly damaging Het
Krt5 T C 15: 101,710,750 M268V probably benign Het
Lama4 T A 10: 39,097,198 L1587Q probably damaging Het
Lhx4 T C 1: 155,705,267 T171A possibly damaging Het
Lrfn2 A C 17: 49,070,348 E152D probably damaging Het
Ltn1 A T 16: 87,432,342 probably benign Het
Ly9 A T 1: 171,593,897 D595E possibly damaging Het
Macf1 A G 4: 123,355,243 L7165P probably damaging Het
Magi3 C T 3: 104,050,825 G648D probably damaging Het
Mgll T A 6: 88,766,324 C109S unknown Het
Micall2 T A 5: 139,717,499 H194L probably damaging Het
Mindy4 T C 6: 55,278,238 L567P probably benign Het
Mmp16 T A 4: 18,051,820 Y270N probably damaging Het
Nme6 T G 9: 109,839,638 F41V probably damaging Het
Npffr1 A G 10: 61,614,160 N71S possibly damaging Het
Olfr1287 A G 2: 111,449,622 I161V probably benign Het
Olfr362 C A 2: 37,105,511 L46F probably damaging Het
Olfr409-ps1 T C 11: 74,317,123 W33R probably damaging Het
Pard3b T A 1: 62,637,867 Y1186N probably damaging Het
Pou2f1 A T 1: 165,880,458 S552T unknown Het
Ppp2r3c A T 12: 55,289,668 L233Q possibly damaging Het
Prl8a1 G A 13: 27,582,086 H9Y possibly damaging Het
Rnf135 C T 11: 80,184,131 T72I probably benign Het
Rsf1 A T 7: 97,678,964 I1058F Het
Slc39a6 A T 18: 24,596,329 Y442* probably null Het
Slc44a2 G A 9: 21,341,857 probably benign Het
Slc4a11 T G 2: 130,687,220 S437R probably damaging Het
Spc24 G A 9: 21,757,698 Q98* probably null Het
Spock3 T A 8: 62,951,952 Y51* probably null Het
Sptbn1 A G 11: 30,117,800 Y1805H probably benign Het
Tango6 A G 8: 106,742,213 I780M probably benign Het
Tcerg1l C T 7: 138,397,531 W41* probably null Het
Tdrd9 A G 12: 112,013,284 Y401C probably benign Het
Tex47 A T 5: 7,305,115 I99F probably damaging Het
Tlr9 G A 9: 106,222,635 probably benign Het
Tmem209 T A 6: 30,497,943 S276C possibly damaging Het
Tmprss11f A C 5: 86,539,759 S97A possibly damaging Het
Ttc7 T A 17: 87,330,092 M425K probably damaging Het
Ttn C T 2: 76,909,122 G3737D unknown Het
Tyk2 T C 9: 21,116,167 H503R probably benign Het
Unc13b A T 4: 43,176,484 R2437S unknown Het
Uqcrc1 C T 9: 108,937,118 R58C probably damaging Het
Vmn1r160 G A 7: 22,872,049 V276I probably benign Het
Vmn2r112 A G 17: 22,618,631 Y691C probably damaging Het
Vmn2r87 A C 10: 130,472,236 I711S probably damaging Het
Vmn2r94 A G 17: 18,244,073 S652P possibly damaging Het
Vps50 T A 6: 3,536,967 C313S probably damaging Het
Xrcc5 T G 1: 72,343,031 D455E possibly damaging Het
Zdhhc6 T A 19: 55,302,555 probably benign Het
Zfp964 G A 8: 69,663,755 G335D probably damaging Het
Other mutations in Naa16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Naa16 APN 14 79355729 missense probably damaging 1.00
IGL01025:Naa16 APN 14 79384756 missense probably damaging 1.00
IGL01155:Naa16 APN 14 79384715 missense probably damaging 0.98
IGL01335:Naa16 APN 14 79345116 splice site probably benign
IGL01981:Naa16 APN 14 79381516 missense probably benign 0.05
IGL02230:Naa16 APN 14 79377361 splice site probably benign
IGL02313:Naa16 APN 14 79384668 missense probably damaging 1.00
IGL02418:Naa16 APN 14 79383366 missense probably damaging 1.00
IGL02544:Naa16 APN 14 79335820 missense probably damaging 1.00
IGL03051:Naa16 APN 14 79369082 missense probably benign 0.01
IGL03064:Naa16 APN 14 79339628 missense probably damaging 0.98
IGL03205:Naa16 APN 14 79356512 missense possibly damaging 0.89
PIT4508001:Naa16 UTSW 14 79369087 missense probably benign 0.15
R0651:Naa16 UTSW 14 79351392 missense probably damaging 1.00
R1429:Naa16 UTSW 14 79359527 missense probably benign 0.01
R1674:Naa16 UTSW 14 79387057 start codon destroyed probably null 0.65
R1693:Naa16 UTSW 14 79351456 missense probably damaging 1.00
R1874:Naa16 UTSW 14 79355743 missense possibly damaging 0.62
R1992:Naa16 UTSW 14 79356491 missense probably damaging 1.00
R2015:Naa16 UTSW 14 79345059 missense probably damaging 1.00
R2391:Naa16 UTSW 14 79370049 missense probably benign 0.16
R2847:Naa16 UTSW 14 79335883 missense probably damaging 1.00
R2848:Naa16 UTSW 14 79335883 missense probably damaging 1.00
R2877:Naa16 UTSW 14 79343298 missense probably benign 0.00
R3884:Naa16 UTSW 14 79343262 missense probably damaging 0.98
R4001:Naa16 UTSW 14 79343121 splice site probably null
R4199:Naa16 UTSW 14 79355871 missense probably damaging 1.00
R4638:Naa16 UTSW 14 79340033 splice site probably null
R4676:Naa16 UTSW 14 79336348 unclassified probably benign
R4690:Naa16 UTSW 14 79345057 missense probably damaging 1.00
R4952:Naa16 UTSW 14 79345085 missense probably damaging 1.00
R5087:Naa16 UTSW 14 79377415 missense possibly damaging 0.68
R5104:Naa16 UTSW 14 79384700 nonsense probably null
R5729:Naa16 UTSW 14 79355780 missense probably damaging 1.00
R6178:Naa16 UTSW 14 79383340 missense possibly damaging 0.93
R6960:Naa16 UTSW 14 79359471 missense possibly damaging 0.65
R7794:Naa16 UTSW 14 79377494 missense probably damaging 1.00
R7936:Naa16 UTSW 14 79341046 missense possibly damaging 0.47
R8356:Naa16 UTSW 14 79359475 missense probably benign 0.00
R8456:Naa16 UTSW 14 79359475 missense probably benign 0.00
R8931:Naa16 UTSW 14 79344955 missense probably damaging 1.00
R9010:Naa16 UTSW 14 79370042 missense probably benign 0.01
R9068:Naa16 UTSW 14 79374849 missense probably benign 0.18
R9360:Naa16 UTSW 14 79356503 missense probably benign 0.05
R9688:Naa16 UTSW 14 79335869 nonsense probably null
X0064:Naa16 UTSW 14 79351389 missense probably damaging 1.00
Z1177:Naa16 UTSW 14 79344979 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGCTTTCATCACGAGGAC -3'
(R):5'- TAAGACGTGACAGGAGCCAC -3'

Sequencing Primer
(F):5'- CTTTCATCACGAGGACGAGTTAG -3'
(R):5'- TCCCGGGTGAGAAGAGTCTAGTC -3'
Posted On 2021-08-02