Incidental Mutation 'R8892:Cramp1'
ID 677788
Institutional Source Beutler Lab
Gene Symbol Cramp1
Ensembl Gene ENSMUSG00000038002
Gene Name cramped chromatin regulator 1
Synonyms 5830477H08Rik, Tce4, Cramp1l
MMRRC Submission 068695-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8892 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 25180200-25234762 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 25202114 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 456 (G456D)
Ref Sequence ENSEMBL: ENSMUSP00000073060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073337]
AlphaFold Q6PG95
Predicted Effect probably damaging
Transcript: ENSMUST00000073337
AA Change: G456D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073060
Gene: ENSMUSG00000038002
AA Change: G456D

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
low complexity region 29 43 N/A INTRINSIC
low complexity region 51 64 N/A INTRINSIC
low complexity region 100 126 N/A INTRINSIC
low complexity region 134 147 N/A INTRINSIC
SANT 159 219 3.68e-3 SMART
low complexity region 479 503 N/A INTRINSIC
low complexity region 548 562 N/A INTRINSIC
low complexity region 792 803 N/A INTRINSIC
low complexity region 833 845 N/A INTRINSIC
low complexity region 889 903 N/A INTRINSIC
low complexity region 1069 1086 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
low complexity region 1141 1156 N/A INTRINSIC
low complexity region 1171 1185 N/A INTRINSIC
Meta Mutation Damage Score 0.1569 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.6%
Validation Efficiency 100% (76/76)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T A 7: 119,815,606 (GRCm39) L285I probably damaging Het
Abcc2 T G 19: 43,795,571 (GRCm39) S442R possibly damaging Het
Adgrl3 A T 5: 81,874,516 (GRCm39) I938F probably damaging Het
Adpgk A G 9: 59,217,623 (GRCm39) Y212C probably damaging Het
Ahcyl1 C T 3: 107,579,378 (GRCm39) D219N probably benign Het
Ap3b1 G A 13: 94,679,348 (GRCm39) V997M unknown Het
Bbs1 A C 19: 4,942,954 (GRCm39) S479A probably benign Het
Bean1 A T 8: 104,943,610 (GRCm39) D231V probably damaging Het
Cacnb1 A T 11: 97,901,192 (GRCm39) V220E probably damaging Het
Camkv C T 9: 107,823,333 (GRCm39) R120* probably null Het
Ccny T G 18: 9,345,235 (GRCm39) S180R probably damaging Het
Cdh23 G T 10: 60,143,284 (GRCm39) H3012Q probably damaging Het
Chd9 A G 8: 91,660,468 (GRCm39) N476S unknown Het
Clasp2 T A 9: 113,709,251 (GRCm39) L680Q probably damaging Het
Clip1 A T 5: 123,717,565 (GRCm39) S1241R probably benign Het
Csmd3 T A 15: 47,604,634 (GRCm39) K1036N Het
Ctnna1 G A 18: 35,372,586 (GRCm39) V514I possibly damaging Het
Ddr1 A C 17: 35,993,556 (GRCm39) I852S probably benign Het
Dhrs1 G A 14: 55,977,404 (GRCm39) A238V possibly damaging Het
Echs1 A C 7: 139,688,031 (GRCm39) L258R probably damaging Het
Epha8 G T 4: 136,661,850 (GRCm39) H582N probably benign Het
Fhod3 G A 18: 25,189,452 (GRCm39) probably null Het
Gm40460 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,450 (GRCm39) probably benign Het
Gpr179 T C 11: 97,226,590 (GRCm39) D1855G possibly damaging Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Ipo9 T C 1: 135,314,544 (GRCm39) N904S possibly damaging Het
Itih3 A G 14: 30,637,635 (GRCm39) V508A probably benign Het
Klhl14 T G 18: 21,691,220 (GRCm39) T437P possibly damaging Het
Krt5 T C 15: 101,619,185 (GRCm39) M268V probably benign Het
Lama4 T A 10: 38,973,194 (GRCm39) L1587Q probably damaging Het
Lhx4 T C 1: 155,581,013 (GRCm39) T171A possibly damaging Het
Lrfn2 A C 17: 49,377,376 (GRCm39) E152D probably damaging Het
Ltn1 A T 16: 87,229,230 (GRCm39) probably benign Het
Ly9 A T 1: 171,421,465 (GRCm39) D595E possibly damaging Het
Macf1 A G 4: 123,249,036 (GRCm39) L7165P probably damaging Het
Magi3 C T 3: 103,958,141 (GRCm39) G648D probably damaging Het
Mgll T A 6: 88,743,306 (GRCm39) C109S unknown Het
Micall2 T A 5: 139,703,254 (GRCm39) H194L probably damaging Het
Mindy4 T C 6: 55,255,223 (GRCm39) L567P probably benign Het
Mmp16 T A 4: 18,051,820 (GRCm39) Y270N probably damaging Het
Naa16 A T 14: 79,628,016 (GRCm39) F14I probably benign Het
Nme6 T G 9: 109,668,706 (GRCm39) F41V probably damaging Het
Npffr1 A G 10: 61,449,939 (GRCm39) N71S possibly damaging Het
Or1b1 C A 2: 36,995,523 (GRCm39) L46F probably damaging Het
Or1p4-ps1 T C 11: 74,207,949 (GRCm39) W33R probably damaging Het
Or4k41 A G 2: 111,279,967 (GRCm39) I161V probably benign Het
Pard3b T A 1: 62,677,026 (GRCm39) Y1186N probably damaging Het
Pou2f1 A T 1: 165,708,027 (GRCm39) S552T unknown Het
Ppp2r3c A T 12: 55,336,453 (GRCm39) L233Q possibly damaging Het
Prl8a1 G A 13: 27,766,069 (GRCm39) H9Y possibly damaging Het
Rnf135 C T 11: 80,074,957 (GRCm39) T72I probably benign Het
Rsf1 A T 7: 97,328,171 (GRCm39) I1058F Het
Slc39a6 A T 18: 24,729,386 (GRCm39) Y442* probably null Het
Slc44a2 G A 9: 21,253,153 (GRCm39) probably benign Het
Slc4a11 T G 2: 130,529,140 (GRCm39) S437R probably damaging Het
Spc24 G A 9: 21,668,994 (GRCm39) Q98* probably null Het
Spock3 T A 8: 63,404,986 (GRCm39) Y51* probably null Het
Sptbn1 A G 11: 30,067,800 (GRCm39) Y1805H probably benign Het
Tango6 A G 8: 107,468,845 (GRCm39) I780M probably benign Het
Tcerg1l C T 7: 137,999,260 (GRCm39) W41* probably null Het
Tdrd9 A G 12: 111,979,718 (GRCm39) Y401C probably benign Het
Tex47 A T 5: 7,355,115 (GRCm39) I99F probably damaging Het
Tlr9 G A 9: 106,099,834 (GRCm39) probably benign Het
Tmem209 T A 6: 30,497,942 (GRCm39) S276C possibly damaging Het
Tmprss11f A C 5: 86,687,618 (GRCm39) S97A possibly damaging Het
Top6bl A G 19: 4,699,721 (GRCm39) V494A possibly damaging Het
Ttc7 T A 17: 87,637,520 (GRCm39) M425K probably damaging Het
Ttn C T 2: 76,739,466 (GRCm39) G3737D unknown Het
Tyk2 T C 9: 21,027,463 (GRCm39) H503R probably benign Het
Unc13b A T 4: 43,176,484 (GRCm39) R2437S unknown Het
Uqcrc1 C T 9: 108,766,186 (GRCm39) R58C probably damaging Het
Vmn1r160 G A 7: 22,571,474 (GRCm39) V276I probably benign Het
Vmn2r112 A G 17: 22,837,612 (GRCm39) Y691C probably damaging Het
Vmn2r87 A C 10: 130,308,105 (GRCm39) I711S probably damaging Het
Vmn2r94 A G 17: 18,464,335 (GRCm39) S652P possibly damaging Het
Vps50 T A 6: 3,536,967 (GRCm39) C313S probably damaging Het
Xrcc5 T G 1: 72,382,190 (GRCm39) D455E possibly damaging Het
Zdhhc6 T A 19: 55,290,987 (GRCm39) probably benign Het
Zfp964 G A 8: 70,116,405 (GRCm39) G335D probably damaging Het
Other mutations in Cramp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Cramp1 APN 17 25,202,925 (GRCm39) missense probably benign 0.11
IGL01360:Cramp1 APN 17 25,216,547 (GRCm39) missense probably damaging 1.00
IGL01966:Cramp1 APN 17 25,201,917 (GRCm39) missense probably benign 0.01
IGL02211:Cramp1 APN 17 25,196,610 (GRCm39) missense possibly damaging 0.94
IGL02474:Cramp1 APN 17 25,204,024 (GRCm39) missense probably damaging 0.98
IGL02798:Cramp1 APN 17 25,187,894 (GRCm39) splice site probably benign
IGL03340:Cramp1 APN 17 25,192,516 (GRCm39) missense probably damaging 1.00
Interred UTSW 17 25,202,956 (GRCm39) missense probably damaging 0.99
R0106:Cramp1 UTSW 17 25,191,350 (GRCm39) missense probably benign 0.30
R1054:Cramp1 UTSW 17 25,202,151 (GRCm39) missense probably damaging 1.00
R1220:Cramp1 UTSW 17 25,201,211 (GRCm39) missense probably damaging 1.00
R1341:Cramp1 UTSW 17 25,196,514 (GRCm39) missense probably damaging 1.00
R1491:Cramp1 UTSW 17 25,191,323 (GRCm39) missense probably benign 0.17
R1610:Cramp1 UTSW 17 25,202,925 (GRCm39) missense probably benign 0.11
R1649:Cramp1 UTSW 17 25,202,217 (GRCm39) missense probably damaging 1.00
R1795:Cramp1 UTSW 17 25,183,884 (GRCm39) missense probably damaging 1.00
R1856:Cramp1 UTSW 17 25,187,952 (GRCm39) missense probably damaging 1.00
R1881:Cramp1 UTSW 17 25,196,656 (GRCm39) splice site probably benign
R1968:Cramp1 UTSW 17 25,183,913 (GRCm39) missense probably damaging 1.00
R2047:Cramp1 UTSW 17 25,222,189 (GRCm39) nonsense probably null
R2099:Cramp1 UTSW 17 25,192,059 (GRCm39) missense probably benign 0.01
R2298:Cramp1 UTSW 17 25,216,454 (GRCm39) missense probably damaging 0.96
R3752:Cramp1 UTSW 17 25,190,532 (GRCm39) missense probably damaging 1.00
R3821:Cramp1 UTSW 17 25,193,756 (GRCm39) missense probably damaging 1.00
R3861:Cramp1 UTSW 17 25,216,588 (GRCm39) splice site probably benign
R4399:Cramp1 UTSW 17 25,198,559 (GRCm39) missense probably damaging 1.00
R4847:Cramp1 UTSW 17 25,204,063 (GRCm39) missense probably damaging 1.00
R4883:Cramp1 UTSW 17 25,201,293 (GRCm39) missense probably benign
R5579:Cramp1 UTSW 17 25,192,087 (GRCm39) missense possibly damaging 0.89
R5631:Cramp1 UTSW 17 25,204,577 (GRCm39) missense possibly damaging 0.93
R5716:Cramp1 UTSW 17 25,193,709 (GRCm39) missense probably damaging 0.99
R6589:Cramp1 UTSW 17 25,196,466 (GRCm39) splice site probably null
R6631:Cramp1 UTSW 17 25,202,931 (GRCm39) missense probably benign 0.40
R7307:Cramp1 UTSW 17 25,193,719 (GRCm39) missense possibly damaging 0.94
R7323:Cramp1 UTSW 17 25,201,379 (GRCm39) missense possibly damaging 0.90
R7672:Cramp1 UTSW 17 25,201,440 (GRCm39) missense probably damaging 0.96
R7832:Cramp1 UTSW 17 25,202,196 (GRCm39) missense probably damaging 0.96
R8071:Cramp1 UTSW 17 25,201,674 (GRCm39) missense probably damaging 0.99
R8244:Cramp1 UTSW 17 25,190,384 (GRCm39) missense probably damaging 1.00
R8430:Cramp1 UTSW 17 25,196,536 (GRCm39) missense probably damaging 1.00
R8783:Cramp1 UTSW 17 25,193,732 (GRCm39) missense probably damaging 0.99
R8890:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R8894:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R8937:Cramp1 UTSW 17 25,202,956 (GRCm39) missense probably damaging 0.99
R8941:Cramp1 UTSW 17 25,202,114 (GRCm39) missense probably damaging 1.00
R9029:Cramp1 UTSW 17 25,232,884 (GRCm39) missense probably damaging 1.00
R9047:Cramp1 UTSW 17 25,198,603 (GRCm39) missense possibly damaging 0.90
R9149:Cramp1 UTSW 17 25,187,920 (GRCm39) missense probably damaging 0.99
R9262:Cramp1 UTSW 17 25,232,920 (GRCm39) missense probably damaging 0.99
R9460:Cramp1 UTSW 17 25,222,281 (GRCm39) missense probably damaging 1.00
R9614:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9615:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9651:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9652:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9653:Cramp1 UTSW 17 25,201,783 (GRCm39) missense probably damaging 1.00
R9665:Cramp1 UTSW 17 25,196,545 (GRCm39) missense probably damaging 1.00
R9753:Cramp1 UTSW 17 25,191,320 (GRCm39) missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GTCTTCTCAAGGTGTGGTCCAG -3'
(R):5'- AGAAGGTGGCATTGCACCTG -3'

Sequencing Primer
(F):5'- TCAAGGTGTGGTCCAGAGTCC -3'
(R):5'- TGTTCCCAGGCGAGAACTG -3'
Posted On 2021-08-02