Incidental Mutation 'R8893:Miga1'
ID 677813
Institutional Source Beutler Lab
Gene Symbol Miga1
Ensembl Gene ENSMUSG00000054942
Gene Name mitoguardin 1
Synonyms C030011O14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8893 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 152273849-152340407 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 152276657 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 594 (L594P)
Ref Sequence ENSEMBL: ENSMUSP00000072836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068243] [ENSMUST00000073089] [ENSMUST00000199334]
AlphaFold Q4QQM5
Predicted Effect probably damaging
Transcript: ENSMUST00000068243
AA Change: L530P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000068261
Gene: ENSMUSG00000054942
AA Change: L530P

DomainStartEndE-ValueType
Pfam:DUF2217 26 306 6.3e-74 PFAM
Pfam:DUF2217 298 507 2.8e-115 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000073089
AA Change: L594P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072836
Gene: ENSMUSG00000054942
AA Change: L594P

DomainStartEndE-ValueType
Pfam:DUF2217 27 571 4.8e-245 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199334
SMART Domains Protein: ENSMUSP00000143238
Gene: ENSMUSG00000054942

DomainStartEndE-ValueType
Pfam:DUF2217 26 496 1.2e-179 PFAM
Meta Mutation Damage Score 0.3104 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 T C 8: 13,224,511 D749G probably benign Het
Ank1 T A 8: 23,108,225 I782N probably damaging Het
Arap2 T A 5: 62,730,694 Q436H probably damaging Het
Baz2b A C 2: 59,924,805 F269L probably damaging Het
BC052040 T A 2: 115,674,784 S179T probably benign Het
Bivm C T 1: 44,119,279 probably benign Het
Brsk1 A T 7: 4,708,090 D603V probably damaging Het
C2cd3 C T 7: 100,454,797 P2006S probably benign Het
Cacna1a T C 8: 84,587,135 F1513L probably benign Het
Cep128 C T 12: 91,296,232 E298K probably damaging Het
Cfap74 A G 4: 155,446,695 T802A unknown Het
Cnbd2 G A 2: 156,312,540 R3Q unknown Het
Cul9 TTCCTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCCTC 17: 46,500,849 probably benign Het
Defa28 C T 8: 21,583,824 T81I Het
Dync1h1 A G 12: 110,642,043 D2735G probably damaging Het
Eif5b A T 1: 38,051,219 I1160F possibly damaging Het
Fzd9 T C 5: 135,250,324 M236V possibly damaging Het
Gm13088 A T 4: 143,655,490 M212K probably damaging Het
Haus6 A G 4: 86,583,127 S836P possibly damaging Het
Hdac5 T A 11: 102,206,686 K167I possibly damaging Het
Heatr5b C G 17: 78,761,995 probably benign Het
Hist1h2ad A G 13: 23,574,490 Q7R unknown Het
Impdh1 G A 6: 29,216,249 probably benign Het
Iqgap3 T C 3: 88,089,886 I192T probably damaging Het
Lama1 C T 17: 67,805,372 A2269V Het
Lamb3 A G 1: 193,332,336 N601S probably damaging Het
Ltbp2 G T 12: 84,828,542 N569K probably damaging Het
Macf1 T C 4: 123,410,530 S60G probably benign Het
March6 A T 15: 31,498,704 V149E probably damaging Het
Mcu A G 10: 59,451,256 S160P probably benign Het
Mindy4 T C 6: 55,278,238 L567P probably benign Het
Ndst2 A G 14: 20,724,762 I791T probably benign Het
Nebl A T 2: 17,730,860 M1K probably null Het
Olfr1344 T C 7: 6,440,286 C129R probably damaging Het
Olfr368 A G 2: 37,332,376 I210V probably damaging Het
Ormdl1 A T 1: 53,305,549 D90V probably damaging Het
Pank1 A T 19: 34,827,503 probably benign Het
Pcdhac2 T A 18: 37,144,018 L17Q probably benign Het
Pde3a A T 6: 141,459,796 D458V probably damaging Het
Pgm2 T G 4: 99,967,100 N323K probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pigw A T 11: 84,877,135 I456K possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plxnc1 T A 10: 94,849,847 I761L probably benign Het
Prkaca A G 8: 83,990,522 N172D probably damaging Het
Rab3b A C 4: 108,940,728 D192A probably benign Het
Rims2 T C 15: 39,534,954 L1105P probably benign Het
Rinl T A 7: 28,792,322 I100N probably damaging Het
Rnf13 T G 3: 57,807,099 I193S probably damaging Het
Rnf213 A G 11: 119,443,042 I3027V Het
Sik2 A T 9: 50,898,726 S512R probably damaging Het
Snx17 A G 5: 31,196,543 Y225C probably damaging Het
Spata13 A T 14: 60,750,075 D894V probably damaging Het
Spx A G 6: 142,414,817 D65G probably damaging Het
Syne1 G T 10: 5,349,020 S1022* probably null Het
Tchh C T 3: 93,447,650 Q1466* probably null Het
Tmem120b T C 5: 123,116,239 L292P probably damaging Het
Vmn2r10 T C 5: 108,995,811 T758A probably benign Het
Vmn2r45 C T 7: 8,485,620 C137Y probably damaging Het
Zfp994 A G 17: 22,205,325 S4P probably damaging Het
Other mutations in Miga1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Miga1 APN 3 152276690 missense probably benign 0.18
IGL01461:Miga1 APN 3 152335297 missense probably damaging 1.00
IGL02962:Miga1 APN 3 152285341 splice site probably benign
R0165:Miga1 UTSW 3 152290843 missense probably damaging 0.99
R0945:Miga1 UTSW 3 152317663 missense possibly damaging 0.85
R1527:Miga1 UTSW 3 152317663 missense possibly damaging 0.85
R1769:Miga1 UTSW 3 152287554 missense probably damaging 1.00
R1978:Miga1 UTSW 3 152335304 frame shift probably null
R3697:Miga1 UTSW 3 152322436 missense probably damaging 0.99
R4649:Miga1 UTSW 3 152279005 missense probably benign 0.28
R4660:Miga1 UTSW 3 152287518 missense probably damaging 1.00
R4679:Miga1 UTSW 3 152322475 missense probably damaging 1.00
R4815:Miga1 UTSW 3 152290806 missense probably benign 0.00
R5019:Miga1 UTSW 3 152322461 missense possibly damaging 0.86
R5488:Miga1 UTSW 3 152333446 small deletion probably benign
R6107:Miga1 UTSW 3 152335399 missense probably benign 0.03
R6227:Miga1 UTSW 3 152278949 missense probably benign 0.09
R6292:Miga1 UTSW 3 152317719 missense probably benign 0.30
R6438:Miga1 UTSW 3 152322403 missense probably damaging 1.00
R6444:Miga1 UTSW 3 152283831 missense probably damaging 1.00
R6489:Miga1 UTSW 3 152279008 missense probably damaging 0.99
R6564:Miga1 UTSW 3 152285322 missense probably damaging 1.00
R7354:Miga1 UTSW 3 152290500 missense probably damaging 1.00
R7440:Miga1 UTSW 3 152338046 critical splice acceptor site probably null
R7638:Miga1 UTSW 3 152276687 missense probably benign 0.00
R8039:Miga1 UTSW 3 152276756 missense probably benign 0.15
R8154:Miga1 UTSW 3 152320700 unclassified probably benign
R8418:Miga1 UTSW 3 152285317 missense probably damaging 1.00
R8423:Miga1 UTSW 3 152322408 missense probably benign 0.00
R8486:Miga1 UTSW 3 152276753 missense probably damaging 1.00
R8825:Miga1 UTSW 3 152276823 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAACCTCCTGCATACGTG -3'
(R):5'- TAAATGCCAATGCCTTGTGTATTCC -3'

Sequencing Primer
(F):5'- TACGTGCAGGACAATCCCCG -3'
(R):5'- TTTCTCAAAGACATCTTCGACTTTG -3'
Posted On 2021-08-02