Incidental Mutation 'R8893:Pgm2'
ID677815
Institutional Source Beutler Lab
Gene Symbol Pgm2
Ensembl Gene ENSMUSG00000025791
Gene Namephosphoglucomutase 2
Synonyms2610020G18Rik, Pgm-2
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.749) question?
Stock #R8893 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location99929414-99987294 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 99967100 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 323 (N323K)
Ref Sequence ENSEMBL: ENSMUSP00000099844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058351] [ENSMUST00000102783]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058351
AA Change: N305K

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000061227
Gene: ENSMUSG00000025791
AA Change: N305K

DomainStartEndE-ValueType
Pfam:PGM_PMM_I 14 158 1.7e-42 PFAM
Pfam:PGM_PMM_II 193 301 3.3e-20 PFAM
Pfam:PGM_PMM_III 306 420 1.1e-33 PFAM
Pfam:PGM_PMM_IV 436 543 1.1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102783
AA Change: N323K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099844
Gene: ENSMUSG00000025791
AA Change: N323K

DomainStartEndE-ValueType
Pfam:PGM_PMM_I 32 176 2.3e-37 PFAM
Pfam:PGM_PMM_II 211 319 1.2e-19 PFAM
Pfam:PGM_PMM_III 324 438 3.7e-33 PFAM
Pfam:PGM_PMM_IV 455 561 3.6e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of phosphoglucomutase (PGM) and belongs to the phosphohexose mutase family. There are several PGM isozymes, which are encoded by different genes and catalyze the transfer of phosphate between the 1 and 6 positions of glucose. In most cell types, this PGM isozyme is predominant, representing about 90% of total PGM activity. In red cells, PGM2 is a major isozyme. This gene is highly polymorphic. Mutations in this gene cause glycogen storage disease type 14. Alternativley spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adprhl1 T C 8: 13,224,511 D749G probably benign Het
Ank1 T A 8: 23,108,225 I782N probably damaging Het
Arap2 T A 5: 62,730,694 Q436H probably damaging Het
Baz2b A C 2: 59,924,805 F269L probably damaging Het
BC052040 T A 2: 115,674,784 S179T probably benign Het
Bivm C T 1: 44,119,279 probably benign Het
Brsk1 A T 7: 4,708,090 D603V probably damaging Het
C2cd3 C T 7: 100,454,797 P2006S probably benign Het
Cacna1a T C 8: 84,587,135 F1513L probably benign Het
Cep128 C T 12: 91,296,232 E298K probably damaging Het
Cfap74 A G 4: 155,446,695 T802A unknown Het
Cnbd2 G A 2: 156,312,540 R3Q unknown Het
Cul9 TTCCTCCTCCTCCTCCTCCTCCTC TTCCTCCTCCTCCTCCTCCTC 17: 46,500,849 probably benign Het
Defa28 C T 8: 21,583,824 T81I Het
Dync1h1 A G 12: 110,642,043 D2735G probably damaging Het
Eif5b A T 1: 38,051,219 I1160F possibly damaging Het
Fzd9 T C 5: 135,250,324 M236V possibly damaging Het
Gm13088 A T 4: 143,655,490 M212K probably damaging Het
Haus6 A G 4: 86,583,127 S836P possibly damaging Het
Hdac5 T A 11: 102,206,686 K167I possibly damaging Het
Hist1h2ad A G 13: 23,574,490 Q7R unknown Het
Impdh1 G A 6: 29,216,249 probably benign Het
Iqgap3 T C 3: 88,089,886 I192T probably damaging Het
Lama1 C T 17: 67,805,372 A2269V Het
Lamb3 A G 1: 193,332,336 N601S probably damaging Het
Ltbp2 G T 12: 84,828,542 N569K probably damaging Het
Macf1 T C 4: 123,410,530 S60G probably benign Het
March6 A T 15: 31,498,704 V149E probably damaging Het
Mcu A G 10: 59,451,256 S160P probably benign Het
Miga1 A G 3: 152,276,657 L594P probably damaging Het
Mindy4 T C 6: 55,278,238 L567P probably benign Het
Ndst2 A G 14: 20,724,762 I791T probably benign Het
Nebl A T 2: 17,730,860 M1K probably null Het
Olfr1344 T C 7: 6,440,286 C129R probably damaging Het
Olfr368 A G 2: 37,332,376 I210V probably damaging Het
Ormdl1 A T 1: 53,305,549 D90V probably damaging Het
Pcdhac2 T A 18: 37,144,018 L17Q probably benign Het
Pde3a A T 6: 141,459,796 D458V probably damaging Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pigw A T 11: 84,877,135 I456K possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plxnc1 T A 10: 94,849,847 I761L probably benign Het
Prkaca A G 8: 83,990,522 N172D probably damaging Het
Rab3b A C 4: 108,940,728 D192A probably benign Het
Rims2 T C 15: 39,534,954 L1105P probably benign Het
Rinl T A 7: 28,792,322 I100N probably damaging Het
Rnf13 T G 3: 57,807,099 I193S probably damaging Het
Rnf213 A G 11: 119,443,042 I3027V Het
Sik2 A T 9: 50,898,726 S512R probably damaging Het
Snx17 A G 5: 31,196,543 Y225C probably damaging Het
Spata13 A T 14: 60,750,075 D894V probably damaging Het
Spx A G 6: 142,414,817 D65G probably damaging Het
Syne1 G T 10: 5,349,020 S1022* probably null Het
Tchh C T 3: 93,447,650 Q1466* probably null Het
Tmem120b T C 5: 123,116,239 L292P probably damaging Het
Vmn2r10 T C 5: 108,995,811 T758A probably benign Het
Vmn2r45 C T 7: 8,485,620 C137Y probably damaging Het
Zfp994 A G 17: 22,205,325 S4P probably damaging Het
Other mutations in Pgm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Pgm2 APN 4 99929606 missense probably damaging 1.00
IGL01468:Pgm2 APN 4 99962170 missense possibly damaging 0.82
IGL02013:Pgm2 APN 4 99983961 splice site probably benign
IGL02237:Pgm2 APN 4 99963510 splice site probably benign
IGL02945:Pgm2 APN 4 99961534 missense probably benign
IGL03201:Pgm2 APN 4 99970039 missense probably damaging 0.99
IGL03373:Pgm2 APN 4 99961544 missense probably damaging 1.00
R0349:Pgm2 UTSW 4 99963617 missense probably damaging 1.00
R0683:Pgm2 UTSW 4 99961543 missense probably damaging 0.99
R1650:Pgm2 UTSW 4 99962070 missense possibly damaging 0.70
R1650:Pgm2 UTSW 4 99962079 missense probably benign 0.28
R1741:Pgm2 UTSW 4 99964865 splice site probably null
R1759:Pgm2 UTSW 4 99967108 missense probably damaging 1.00
R1843:Pgm2 UTSW 4 99961478 missense probably damaging 1.00
R3111:Pgm2 UTSW 4 99956025 missense probably benign
R4115:Pgm2 UTSW 4 99962151 nonsense probably null
R4426:Pgm2 UTSW 4 99962140 missense probably benign 0.04
R4748:Pgm2 UTSW 4 99981979 missense probably benign 0.24
R4910:Pgm2 UTSW 4 99963527 missense probably damaging 1.00
R4920:Pgm2 UTSW 4 99986733 missense probably damaging 1.00
R5289:Pgm2 UTSW 4 99967069 missense probably damaging 1.00
R5764:Pgm2 UTSW 4 99964846 missense probably damaging 1.00
R6199:Pgm2 UTSW 4 99978954 missense probably damaging 1.00
R6311:Pgm2 UTSW 4 99970040 missense possibly damaging 0.93
R6600:Pgm2 UTSW 4 99967062 nonsense probably null
R6818:Pgm2 UTSW 4 99963566 missense probably damaging 1.00
R6892:Pgm2 UTSW 4 99929708 missense probably benign
R6984:Pgm2 UTSW 4 99929654 missense probably benign 0.04
R7429:Pgm2 UTSW 4 99955995 start codon destroyed probably null
R7430:Pgm2 UTSW 4 99955995 start codon destroyed probably null
R8017:Pgm2 UTSW 4 99986678 missense probably benign 0.00
R8019:Pgm2 UTSW 4 99986678 missense probably benign 0.00
R8143:Pgm2 UTSW 4 99967218 splice site probably null
R8724:Pgm2 UTSW 4 99929767 missense probably benign 0.00
RF018:Pgm2 UTSW 4 99962303 splice site probably null
Z1176:Pgm2 UTSW 4 99978997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCCTACAGTGTTGTACAAATTC -3'
(R):5'- AGAAAGACTGCAGCCACTGG -3'

Sequencing Primer
(F):5'- GTACAAATTCACTAAAAAGTCCAGTG -3'
(R):5'- AGGATGTGTGCTCCAGGC -3'
Posted On2021-08-02