Incidental Mutation 'R8894:Hapln3'
ID 677884
Institutional Source Beutler Lab
Gene Symbol Hapln3
Ensembl Gene ENSMUSG00000030606
Gene Name hyaluronan and proteoglycan link protein 3
Synonyms Lpr3, 4930554N11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock # R8894 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 79115102-79131018 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 79117491 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 267 (R267W)
Ref Sequence ENSEMBL: ENSMUSP00000146090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032827] [ENSMUST00000032835] [ENSMUST00000205782] [ENSMUST00000206092]
AlphaFold Q80WM5
Predicted Effect probably benign
Transcript: ENSMUST00000032827
SMART Domains Protein: ENSMUSP00000032827
Gene: ENSMUSG00000030606

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IGv 65 148 3.28e-8 SMART
LINK 164 261 1.78e-46 SMART
LINK 265 357 3.14e-47 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000032835
SMART Domains Protein: ENSMUSP00000032835
Gene: ENSMUSG00000030607

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 46 135 3.46e-7 SMART
LINK 151 248 1.76e-59 SMART
LINK 252 350 4.13e-65 SMART
LINK 485 582 1.03e-51 SMART
LINK 586 684 9.58e-61 SMART
low complexity region 767 794 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 890 904 N/A INTRINSIC
low complexity region 913 930 N/A INTRINSIC
low complexity region 966 987 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
low complexity region 1484 1495 N/A INTRINSIC
low complexity region 1707 1720 N/A INTRINSIC
low complexity region 1808 1823 N/A INTRINSIC
low complexity region 1904 1915 N/A INTRINSIC
CLECT 1922 2043 2.13e-37 SMART
CCP 2049 2105 9.32e-11 SMART
low complexity region 2118 2130 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205782
Predicted Effect probably benign
Transcript: ENSMUST00000206092
AA Change: R267W

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000206779
Meta Mutation Damage Score 0.5152 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the hyaluronan and proteoglycan binding link protein gene family. The protein encoded by this gene may function in hyaluronic acid binding and cell adhesion. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik C T 9: 46,305,099 V291M probably benign Het
Abca14 A C 7: 120,248,145 Y744S probably damaging Het
Acly T C 11: 100,516,813 E237G probably benign Het
Adcy1 T A 11: 7,137,375 D416E probably damaging Het
Arid1b T A 17: 5,327,393 M1217K probably damaging Het
Atad2b T C 12: 5,014,001 probably null Het
Ccdc177 A G 12: 80,759,303 S66P probably damaging Het
Clpsl2 T C 17: 28,550,671 C36R possibly damaging Het
Cramp1l C T 17: 24,983,140 G456D probably damaging Het
Crb1 T A 1: 139,248,012 L744F possibly damaging Het
Crybg3 T A 16: 59,522,189 E980D probably damaging Het
Cyp2d11 A T 15: 82,390,470 V302E probably benign Het
Cyp3a25 A C 5: 145,994,860 probably benign Het
Dhx35 G C 2: 158,834,875 A410P possibly damaging Het
Dlg2 A T 7: 91,965,738 H295L probably benign Het
Dnah2 T A 11: 69,492,222 M1172L probably benign Het
Dock9 T C 14: 121,622,961 S850G probably benign Het
Dst A T 1: 34,174,133 M1369L possibly damaging Het
Fam205a1 A G 4: 42,853,688 C47R possibly damaging Het
Fcrl6 T C 1: 172,599,289 N30S probably benign Het
Fibp A T 19: 5,463,281 Q208L probably benign Het
Foxc1 T G 13: 31,808,222 S339A unknown Het
Fras1 T C 5: 96,759,543 C3196R probably damaging Het
Galnt7 C T 8: 57,526,142 W649* probably null Het
Gm7682 T G 5: 94,448,540 C479G probably damaging Het
H2-M10.2 T C 17: 36,284,663 N245S possibly damaging Het
Hkdc1 T C 10: 62,408,621 I229V probably damaging Het
Kank1 G A 19: 25,431,014 G1286R probably damaging Het
Krba1 A G 6: 48,411,695 I543V probably damaging Het
Lipn A T 19: 34,084,848 *401L probably null Het
Lrrc37a T C 11: 103,456,623 N3082S unknown Het
Magi1 A T 6: 93,686,605 F1117Y probably benign Het
Man2a1 A G 17: 64,713,601 K791E probably benign Het
Mindy4 T C 6: 55,278,238 L567P probably benign Het
Mpp4 A G 1: 59,158,584 probably null Het
Muc2 T G 7: 141,694,515 C371W probably damaging Het
Nebl A T 2: 17,375,225 N779K probably benign Het
Nf1 T C 11: 79,445,793 L1066P probably damaging Het
Npat T C 9: 53,556,651 L302P probably damaging Het
Nudt21 C A 8: 94,028,870 G146W probably damaging Het
Olfr1205 T G 2: 88,831,465 M116R probably benign Het
Olfr122 T A 17: 37,772,049 I132K probably damaging Het
Olfr1510 A T 14: 52,410,008 L288Q probably damaging Het
Olfr891 A T 9: 38,180,074 F250I probably damaging Het
Pkd2l2 T C 18: 34,438,220 probably benign Het
Plcd3 T A 11: 103,071,766 N620Y probably damaging Het
Ppl T C 16: 5,107,342 probably benign Het
Prep T C 10: 45,158,524 *711Q probably null Het
Psap T A 10: 60,299,957 V394E possibly damaging Het
Ptprr T A 10: 116,048,345 D102E probably benign Het
Rgsl1 T A 1: 153,822,373 probably null Het
Rimbp2 T A 5: 128,773,390 D943V possibly damaging Het
Rsrc2 G T 5: 123,740,730 R113S unknown Het
Sim1 T A 10: 50,910,530 V286E possibly damaging Het
Slc35d1 A T 4: 103,211,332 F124L Het
Sort1 T C 3: 108,338,912 F402L probably damaging Het
Tcrg-V4 T C 13: 19,185,457 S124P probably damaging Het
Tlr2 T A 3: 83,836,784 E664V probably damaging Het
Tmppe A T 9: 114,401,192 probably benign Het
Tnfrsf8 T C 4: 145,274,468 D356G possibly damaging Het
Tnrc18 T C 5: 142,739,457 E1839G unknown Het
Trim17 T A 11: 58,968,710 M250K probably benign Het
Trim33 C T 3: 103,311,491 L315F probably damaging Het
Vmn1r43 A G 6: 89,869,764 S247P probably benign Het
Vmn2r33 T A 7: 7,563,810 Y101F probably benign Het
Vmn2r40 T C 7: 8,920,198 D388G Het
Wdr36 C T 18: 32,837,287 probably benign Het
Zfp2 T A 11: 50,901,016 I67F possibly damaging Het
Other mutations in Hapln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Hapln3 APN 7 79121983 missense probably damaging 1.00
IGL01412:Hapln3 APN 7 79117436 splice site probably null
IGL02141:Hapln3 APN 7 79118145 missense probably damaging 0.99
IGL02675:Hapln3 APN 7 79117848 critical splice donor site probably null
IGL02864:Hapln3 APN 7 79118064 missense probably benign 0.03
IGL02894:Hapln3 APN 7 79121773 missense probably benign 0.03
R1271:Hapln3 UTSW 7 79118016 missense probably damaging 1.00
R1337:Hapln3 UTSW 7 79118076 missense probably benign 0.06
R1351:Hapln3 UTSW 7 79121960 missense probably damaging 1.00
R1686:Hapln3 UTSW 7 79121890 missense probably benign 0.13
R1718:Hapln3 UTSW 7 79123450 missense unknown
R3103:Hapln3 UTSW 7 79121736 missense probably benign 0.07
R5625:Hapln3 UTSW 7 79117258 splice site probably null
R5669:Hapln3 UTSW 7 79117496 splice site probably null
R5862:Hapln3 UTSW 7 79121891 missense possibly damaging 0.84
R5875:Hapln3 UTSW 7 79121973 missense probably benign 0.03
R7129:Hapln3 UTSW 7 79121824 missense probably damaging 1.00
R7439:Hapln3 UTSW 7 79117269 missense probably benign 0.00
R7713:Hapln3 UTSW 7 79117373 missense probably benign 0.00
R8896:Hapln3 UTSW 7 79117491 missense probably benign 0.00
R8933:Hapln3 UTSW 7 79117630 unclassified probably benign
R9114:Hapln3 UTSW 7 79121964 missense probably benign 0.00
R9367:Hapln3 UTSW 7 79121707 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGTTGAGTCGAGGGTGAAC -3'
(R):5'- GCTCACTCAGAATGCAATTGGG -3'

Sequencing Primer
(F):5'- ACTATAGGGTAGCGGGCACTTC -3'
(R):5'- TGCAATTGGGGCATACAGAAATGAC -3'
Posted On 2021-08-02