Incidental Mutation 'R8894:Atad2b'
ID 677907
Institutional Source Beutler Lab
Gene Symbol Atad2b
Ensembl Gene ENSMUSG00000052812
Gene Name ATPase family, AAA domain containing 2B
Synonyms D530031C13Rik, 1110014E10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8894 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 4917353-5047394 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 5014001 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000047445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045664] [ENSMUST00000218859]
AlphaFold E9Q166
Predicted Effect probably null
Transcript: ENSMUST00000045664
SMART Domains Protein: ENSMUSP00000047445
Gene: ENSMUSG00000052812

DomainStartEndE-ValueType
low complexity region 13 54 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 252 278 N/A INTRINSIC
AAA 432 573 4.56e-20 SMART
SCOP:d1e32a2 771 912 3e-4 SMART
BROMO 958 1070 4.24e-20 SMART
low complexity region 1135 1144 N/A INTRINSIC
low complexity region 1230 1253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218859
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AAA ATPase family. This family member includes an N-terminal bromodomain. It has been found to be localized to the nucleus, partly to replication sites, consistent with a chromatin-related function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit reduced body size and fertility in female mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik C T 9: 46,305,099 V291M probably benign Het
Abca14 A C 7: 120,248,145 Y744S probably damaging Het
Acly T C 11: 100,516,813 E237G probably benign Het
Adcy1 T A 11: 7,137,375 D416E probably damaging Het
Arid1b T A 17: 5,327,393 M1217K probably damaging Het
Ccdc177 A G 12: 80,759,303 S66P probably damaging Het
Clpsl2 T C 17: 28,550,671 C36R possibly damaging Het
Cramp1l C T 17: 24,983,140 G456D probably damaging Het
Crb1 T A 1: 139,248,012 L744F possibly damaging Het
Crybg3 T A 16: 59,522,189 E980D probably damaging Het
Cyp2d11 A T 15: 82,390,470 V302E probably benign Het
Cyp3a25 A C 5: 145,994,860 probably benign Het
Dhx35 G C 2: 158,834,875 A410P possibly damaging Het
Dlg2 A T 7: 91,965,738 H295L probably benign Het
Dnah2 T A 11: 69,492,222 M1172L probably benign Het
Dock9 T C 14: 121,622,961 S850G probably benign Het
Dst A T 1: 34,174,133 M1369L possibly damaging Het
Fam205a1 A G 4: 42,853,688 C47R possibly damaging Het
Fcrl6 T C 1: 172,599,289 N30S probably benign Het
Fibp A T 19: 5,463,281 Q208L probably benign Het
Foxc1 T G 13: 31,808,222 S339A unknown Het
Fras1 T C 5: 96,759,543 C3196R probably damaging Het
Galnt7 C T 8: 57,526,142 W649* probably null Het
Gm7682 T G 5: 94,448,540 C479G probably damaging Het
H2-M10.2 T C 17: 36,284,663 N245S possibly damaging Het
Hapln3 G A 7: 79,117,491 R267W probably benign Het
Hkdc1 T C 10: 62,408,621 I229V probably damaging Het
Kank1 G A 19: 25,431,014 G1286R probably damaging Het
Krba1 A G 6: 48,411,695 I543V probably damaging Het
Lipn A T 19: 34,084,848 *401L probably null Het
Lrrc37a T C 11: 103,456,623 N3082S unknown Het
Magi1 A T 6: 93,686,605 F1117Y probably benign Het
Man2a1 A G 17: 64,713,601 K791E probably benign Het
Mindy4 T C 6: 55,278,238 L567P probably benign Het
Mpp4 A G 1: 59,158,584 probably null Het
Muc2 T G 7: 141,694,515 C371W probably damaging Het
Nebl A T 2: 17,375,225 N779K probably benign Het
Nf1 T C 11: 79,445,793 L1066P probably damaging Het
Npat T C 9: 53,556,651 L302P probably damaging Het
Nudt21 C A 8: 94,028,870 G146W probably damaging Het
Olfr1205 T G 2: 88,831,465 M116R probably benign Het
Olfr122 T A 17: 37,772,049 I132K probably damaging Het
Olfr1510 A T 14: 52,410,008 L288Q probably damaging Het
Olfr891 A T 9: 38,180,074 F250I probably damaging Het
Pkd2l2 T C 18: 34,438,220 probably benign Het
Plcd3 T A 11: 103,071,766 N620Y probably damaging Het
Ppl T C 16: 5,107,342 probably benign Het
Prep T C 10: 45,158,524 *711Q probably null Het
Psap T A 10: 60,299,957 V394E possibly damaging Het
Ptprr T A 10: 116,048,345 D102E probably benign Het
Rgsl1 T A 1: 153,822,373 probably null Het
Rimbp2 T A 5: 128,773,390 D943V possibly damaging Het
Rsrc2 G T 5: 123,740,730 R113S unknown Het
Sim1 T A 10: 50,910,530 V286E possibly damaging Het
Slc35d1 A T 4: 103,211,332 F124L Het
Sort1 T C 3: 108,338,912 F402L probably damaging Het
Tcrg-V4 T C 13: 19,185,457 S124P probably damaging Het
Tlr2 T A 3: 83,836,784 E664V probably damaging Het
Tmppe A T 9: 114,401,192 probably benign Het
Tnfrsf8 T C 4: 145,274,468 D356G possibly damaging Het
Tnrc18 T C 5: 142,739,457 E1839G unknown Het
Trim17 T A 11: 58,968,710 M250K probably benign Het
Trim33 C T 3: 103,311,491 L315F probably damaging Het
Vmn1r43 A G 6: 89,869,764 S247P probably benign Het
Vmn2r33 T A 7: 7,563,810 Y101F probably benign Het
Vmn2r40 T C 7: 8,920,198 D388G Het
Wdr36 C T 18: 32,837,287 probably benign Het
Zfp2 T A 11: 50,901,016 I67F possibly damaging Het
Other mutations in Atad2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Atad2b APN 12 5024593 missense probably damaging 1.00
IGL00917:Atad2b APN 12 4965837 unclassified probably benign
IGL01011:Atad2b APN 12 4965984 missense probably benign 0.01
IGL01092:Atad2b APN 12 5017987 missense probably damaging 0.98
IGL01604:Atad2b APN 12 4965837 unclassified probably benign
IGL01924:Atad2b APN 12 5034093 missense probably damaging 1.00
IGL02197:Atad2b APN 12 5018056 missense possibly damaging 0.84
IGL02397:Atad2b APN 12 4974046 missense probably damaging 1.00
IGL02404:Atad2b APN 12 4941972 missense probably benign 0.08
IGL02517:Atad2b APN 12 5018037 missense probably benign 0.07
IGL02726:Atad2b APN 12 4974003 nonsense probably null
IGL02896:Atad2b APN 12 4958151 missense probably damaging 1.00
IGL03227:Atad2b APN 12 5006715 missense probably damaging 1.00
IGL03265:Atad2b APN 12 5024628 missense probably benign 0.24
Plyers UTSW 12 4973970 missense probably damaging 1.00
Smidge UTSW 12 4990949 missense probably damaging 1.00
Tensor UTSW 12 4957558 missense probably damaging 1.00
Traction UTSW 12 5027182 critical splice donor site probably null
Vice UTSW 12 5018002 missense probably damaging 1.00
K3955:Atad2b UTSW 12 4954536 splice site probably benign
P0038:Atad2b UTSW 12 4954536 splice site probably benign
PIT4418001:Atad2b UTSW 12 5024587 missense probably benign 0.07
PIT4431001:Atad2b UTSW 12 5031795 missense possibly damaging 0.77
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0006:Atad2b UTSW 12 4942030 missense possibly damaging 0.81
R0124:Atad2b UTSW 12 4952676 missense probably benign 0.23
R0462:Atad2b UTSW 12 4941973 missense possibly damaging 0.79
R0483:Atad2b UTSW 12 4945035 splice site probably benign
R0617:Atad2b UTSW 12 4937401 missense probably benign 0.43
R0894:Atad2b UTSW 12 4965915 missense probably damaging 1.00
R0942:Atad2b UTSW 12 5024591 missense probably damaging 1.00
R0960:Atad2b UTSW 12 5006593 splice site probably benign
R0973:Atad2b UTSW 12 5031784 missense probably benign 0.00
R1306:Atad2b UTSW 12 4974239 missense probably benign 0.08
R1530:Atad2b UTSW 12 4942018 nonsense probably null
R1678:Atad2b UTSW 12 4965899 missense possibly damaging 0.91
R1689:Atad2b UTSW 12 5034575 nonsense probably null
R1826:Atad2b UTSW 12 4974094 missense probably benign 0.00
R1996:Atad2b UTSW 12 4990883 missense probably benign 0.01
R2233:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2235:Atad2b UTSW 12 5006745 missense probably damaging 1.00
R2943:Atad2b UTSW 12 4942067 missense probably damaging 0.98
R3161:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3162:Atad2b UTSW 12 4939689 missense possibly damaging 0.87
R3508:Atad2b UTSW 12 4950595 critical splice donor site probably null
R4239:Atad2b UTSW 12 4985710 missense probably benign 0.05
R4401:Atad2b UTSW 12 4940145 missense probably damaging 0.99
R4558:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4559:Atad2b UTSW 12 4943223 missense probably benign 0.10
R4573:Atad2b UTSW 12 4954663 splice site probably null
R4639:Atad2b UTSW 12 5018053 missense probably damaging 1.00
R4847:Atad2b UTSW 12 4944901 splice site probably null
R4850:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4851:Atad2b UTSW 12 4943251 missense probably benign 0.15
R4979:Atad2b UTSW 12 5034513 missense probably damaging 1.00
R5024:Atad2b UTSW 12 4937534 missense probably benign 0.45
R5305:Atad2b UTSW 12 4965855 missense probably damaging 1.00
R5405:Atad2b UTSW 12 4940098 missense possibly damaging 0.87
R5627:Atad2b UTSW 12 4917911 missense probably benign 0.01
R5754:Atad2b UTSW 12 5010351 missense probably benign 0.01
R6163:Atad2b UTSW 12 4954593 missense probably benign 0.00
R6371:Atad2b UTSW 12 4973970 missense probably damaging 1.00
R6374:Atad2b UTSW 12 5018002 missense probably damaging 1.00
R6399:Atad2b UTSW 12 4957558 missense probably damaging 1.00
R6433:Atad2b UTSW 12 4952642 missense possibly damaging 0.89
R6546:Atad2b UTSW 12 4990949 missense probably damaging 1.00
R6617:Atad2b UTSW 12 5024668 missense probably benign 0.00
R7199:Atad2b UTSW 12 5017992 missense probably damaging 1.00
R7267:Atad2b UTSW 12 5027105 nonsense probably null
R7405:Atad2b UTSW 12 4943232 missense probably benign 0.08
R7460:Atad2b UTSW 12 4952660 missense probably benign 0.28
R7568:Atad2b UTSW 12 5010390 critical splice donor site probably null
R7593:Atad2b UTSW 12 5031726 missense probably benign 0.16
R7648:Atad2b UTSW 12 5027182 critical splice donor site probably null
R8253:Atad2b UTSW 12 4974159 missense possibly damaging 0.54
R8253:Atad2b UTSW 12 4974160 missense probably benign 0.02
R8708:Atad2b UTSW 12 4961253 missense probably damaging 1.00
R8948:Atad2b UTSW 12 4991012 missense possibly damaging 0.87
R8976:Atad2b UTSW 12 4917923 critical splice donor site probably null
R9052:Atad2b UTSW 12 4965982 missense probably damaging 1.00
R9057:Atad2b UTSW 12 5018102 nonsense probably null
R9134:Atad2b UTSW 12 5010351 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAGTCCTGGCTTATCATCCTAAATC -3'
(R):5'- AAAAGTCACCAGGTGTTTGCTG -3'

Sequencing Primer
(F):5'- AGCTCTTCGTGCTATGGAAG -3'
(R):5'- GCTGGTAACACTGGTAGTTATCAC -3'
Posted On 2021-08-02