Incidental Mutation 'R8894:Dock9'
ID 677912
Institutional Source Beutler Lab
Gene Symbol Dock9
Ensembl Gene ENSMUSG00000025558
Gene Name dedicator of cytokinesis 9
Synonyms D14Wsu89e, Zizimin1, B230309H04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8894 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 121542046-121797837 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 121622961 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 850 (S850G)
Ref Sequence ENSEMBL: ENSMUSP00000148834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040700] [ENSMUST00000100299] [ENSMUST00000212181] [ENSMUST00000212376]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000040700
AA Change: S850G

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558
AA Change: S850G

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100299
AA Change: S852G

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558
AA Change: S852G

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212181
AA Change: S850G

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000212376
AA Change: S864G

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.1222 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429L15Rik C T 9: 46,305,099 V291M probably benign Het
Abca14 A C 7: 120,248,145 Y744S probably damaging Het
Acly T C 11: 100,516,813 E237G probably benign Het
Adcy1 T A 11: 7,137,375 D416E probably damaging Het
Arid1b T A 17: 5,327,393 M1217K probably damaging Het
Atad2b T C 12: 5,014,001 probably null Het
Ccdc177 A G 12: 80,759,303 S66P probably damaging Het
Clpsl2 T C 17: 28,550,671 C36R possibly damaging Het
Cramp1l C T 17: 24,983,140 G456D probably damaging Het
Crb1 T A 1: 139,248,012 L744F possibly damaging Het
Crybg3 T A 16: 59,522,189 E980D probably damaging Het
Cyp2d11 A T 15: 82,390,470 V302E probably benign Het
Cyp3a25 A C 5: 145,994,860 probably benign Het
Dhx35 G C 2: 158,834,875 A410P possibly damaging Het
Dlg2 A T 7: 91,965,738 H295L probably benign Het
Dnah2 T A 11: 69,492,222 M1172L probably benign Het
Dst A T 1: 34,174,133 M1369L possibly damaging Het
Fam205a1 A G 4: 42,853,688 C47R possibly damaging Het
Fcrl6 T C 1: 172,599,289 N30S probably benign Het
Fibp A T 19: 5,463,281 Q208L probably benign Het
Foxc1 T G 13: 31,808,222 S339A unknown Het
Fras1 T C 5: 96,759,543 C3196R probably damaging Het
Galnt7 C T 8: 57,526,142 W649* probably null Het
Gm7682 T G 5: 94,448,540 C479G probably damaging Het
H2-M10.2 T C 17: 36,284,663 N245S possibly damaging Het
Hapln3 G A 7: 79,117,491 R267W probably benign Het
Hkdc1 T C 10: 62,408,621 I229V probably damaging Het
Kank1 G A 19: 25,431,014 G1286R probably damaging Het
Krba1 A G 6: 48,411,695 I543V probably damaging Het
Lipn A T 19: 34,084,848 *401L probably null Het
Lrrc37a T C 11: 103,456,623 N3082S unknown Het
Magi1 A T 6: 93,686,605 F1117Y probably benign Het
Man2a1 A G 17: 64,713,601 K791E probably benign Het
Mindy4 T C 6: 55,278,238 L567P probably benign Het
Mpp4 A G 1: 59,158,584 probably null Het
Muc2 T G 7: 141,694,515 C371W probably damaging Het
Nebl A T 2: 17,375,225 N779K probably benign Het
Nf1 T C 11: 79,445,793 L1066P probably damaging Het
Npat T C 9: 53,556,651 L302P probably damaging Het
Nudt21 C A 8: 94,028,870 G146W probably damaging Het
Olfr1205 T G 2: 88,831,465 M116R probably benign Het
Olfr122 T A 17: 37,772,049 I132K probably damaging Het
Olfr1510 A T 14: 52,410,008 L288Q probably damaging Het
Olfr891 A T 9: 38,180,074 F250I probably damaging Het
Pkd2l2 T C 18: 34,438,220 probably benign Het
Plcd3 T A 11: 103,071,766 N620Y probably damaging Het
Ppl T C 16: 5,107,342 probably benign Het
Prep T C 10: 45,158,524 *711Q probably null Het
Psap T A 10: 60,299,957 V394E possibly damaging Het
Ptprr T A 10: 116,048,345 D102E probably benign Het
Rgsl1 T A 1: 153,822,373 probably null Het
Rimbp2 T A 5: 128,773,390 D943V possibly damaging Het
Rsrc2 G T 5: 123,740,730 R113S unknown Het
Sim1 T A 10: 50,910,530 V286E possibly damaging Het
Slc35d1 A T 4: 103,211,332 F124L Het
Sort1 T C 3: 108,338,912 F402L probably damaging Het
Tcrg-V4 T C 13: 19,185,457 S124P probably damaging Het
Tlr2 T A 3: 83,836,784 E664V probably damaging Het
Tmppe A T 9: 114,401,192 probably benign Het
Tnfrsf8 T C 4: 145,274,468 D356G possibly damaging Het
Tnrc18 T C 5: 142,739,457 E1839G unknown Het
Trim17 T A 11: 58,968,710 M250K probably benign Het
Trim33 C T 3: 103,311,491 L315F probably damaging Het
Vmn1r43 A G 6: 89,869,764 S247P probably benign Het
Vmn2r33 T A 7: 7,563,810 Y101F probably benign Het
Vmn2r40 T C 7: 8,920,198 D388G Het
Wdr36 C T 18: 32,837,287 probably benign Het
Zfp2 T A 11: 50,901,016 I67F possibly damaging Het
Other mutations in Dock9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Dock9 APN 14 121668468 missense probably benign 0.12
IGL00817:Dock9 APN 14 121698291 missense probably damaging 0.96
IGL00923:Dock9 APN 14 121607092 unclassified probably benign
IGL01385:Dock9 APN 14 121580583 missense possibly damaging 0.94
IGL01567:Dock9 APN 14 121653084 missense probably damaging 1.00
IGL01767:Dock9 APN 14 121622870 missense possibly damaging 0.91
IGL01811:Dock9 APN 14 121559028 missense probably damaging 1.00
IGL02512:Dock9 APN 14 121619538 splice site probably benign
IGL02525:Dock9 APN 14 121640126 missense probably damaging 1.00
IGL02550:Dock9 APN 14 121698312 start codon destroyed probably null 0.07
IGL02559:Dock9 APN 14 121625147 splice site probably benign
IGL02666:Dock9 APN 14 121580699 missense probably benign 0.42
IGL02674:Dock9 APN 14 121595611 splice site probably null
IGL02795:Dock9 APN 14 121639978 missense probably benign 0.04
IGL03074:Dock9 APN 14 121607270 missense possibly damaging 0.95
IGL03095:Dock9 APN 14 121639528 missense probably damaging 1.00
IGL03294:Dock9 APN 14 121641623 splice site probably benign
R0036:Dock9 UTSW 14 121622853 missense probably damaging 1.00
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0270:Dock9 UTSW 14 121575999 missense probably benign 0.02
R0494:Dock9 UTSW 14 121662584 missense possibly damaging 0.64
R0726:Dock9 UTSW 14 121651768 nonsense probably null
R1029:Dock9 UTSW 14 121599684 splice site probably null
R1214:Dock9 UTSW 14 121586316 missense probably benign 0.02
R1231:Dock9 UTSW 14 121575950 missense possibly damaging 0.61
R1535:Dock9 UTSW 14 121546064 missense probably damaging 1.00
R1629:Dock9 UTSW 14 121543574 missense possibly damaging 0.88
R1637:Dock9 UTSW 14 121651775 missense possibly damaging 0.66
R1733:Dock9 UTSW 14 121626880 missense probably benign 0.01
R1772:Dock9 UTSW 14 121609798 missense probably benign 0.07
R1855:Dock9 UTSW 14 121640159 missense probably damaging 1.00
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1901:Dock9 UTSW 14 121625153 splice site probably null
R1920:Dock9 UTSW 14 121583380 missense probably damaging 1.00
R1987:Dock9 UTSW 14 121591830 missense probably benign 0.00
R3035:Dock9 UTSW 14 121606837 missense possibly damaging 0.60
R3851:Dock9 UTSW 14 121629086 splice site probably null
R4020:Dock9 UTSW 14 121606855 missense probably benign 0.00
R4021:Dock9 UTSW 14 121626912 missense possibly damaging 0.80
R4089:Dock9 UTSW 14 121583471 missense probably damaging 1.00
R4258:Dock9 UTSW 14 121581442 missense probably benign 0.00
R4423:Dock9 UTSW 14 121562053 critical splice donor site probably null
R4561:Dock9 UTSW 14 121559007 missense probably benign 0.01
R4604:Dock9 UTSW 14 121668459 missense probably damaging 1.00
R4646:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4647:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4776:Dock9 UTSW 14 121610097 missense possibly damaging 0.81
R4809:Dock9 UTSW 14 121546596 missense probably benign 0.37
R4865:Dock9 UTSW 14 121543505 makesense probably null
R4951:Dock9 UTSW 14 121653135 missense probably benign 0.35
R5151:Dock9 UTSW 14 121578170 missense probably damaging 1.00
R5359:Dock9 UTSW 14 121653060 missense possibly damaging 0.69
R5366:Dock9 UTSW 14 121578203 missense probably damaging 1.00
R5502:Dock9 UTSW 14 121610182 splice site probably null
R5579:Dock9 UTSW 14 121599695 missense probably damaging 1.00
R5753:Dock9 UTSW 14 121634625 missense probably benign 0.05
R5836:Dock9 UTSW 14 121681351 missense probably damaging 1.00
R5858:Dock9 UTSW 14 121628792 missense probably benign 0.00
R5890:Dock9 UTSW 14 121668408 critical splice donor site probably null
R6075:Dock9 UTSW 14 121545973 missense probably benign
R6298:Dock9 UTSW 14 121634594 missense probably damaging 1.00
R6306:Dock9 UTSW 14 121562080 missense probably damaging 1.00
R6321:Dock9 UTSW 14 121546021 missense probably damaging 1.00
R6330:Dock9 UTSW 14 121605243 start codon destroyed probably null 0.00
R6719:Dock9 UTSW 14 121610027 missense probably damaging 1.00
R6784:Dock9 UTSW 14 121543514 missense probably damaging 1.00
R6826:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6830:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6838:Dock9 UTSW 14 121546596 missense possibly damaging 0.71
R6868:Dock9 UTSW 14 121586264 missense probably benign 0.37
R6919:Dock9 UTSW 14 121643152 missense probably benign 0.42
R6989:Dock9 UTSW 14 121627379 missense probably damaging 1.00
R7539:Dock9 UTSW 14 121581436 missense probably damaging 1.00
R7645:Dock9 UTSW 14 121597663 missense probably benign 0.44
R7875:Dock9 UTSW 14 121625984 nonsense probably null
R7900:Dock9 UTSW 14 121546079 missense possibly damaging 0.84
R8040:Dock9 UTSW 14 121651794 missense probably benign 0.06
R8420:Dock9 UTSW 14 121546042 missense probably damaging 1.00
R8511:Dock9 UTSW 14 121627389 missense probably benign 0.40
R8511:Dock9 UTSW 14 121681435 missense probably damaging 1.00
R8514:Dock9 UTSW 14 121658787 missense probably benign 0.25
R8691:Dock9 UTSW 14 121640105 missense possibly damaging 0.49
R8804:Dock9 UTSW 14 121605183 missense probably damaging 0.98
R8900:Dock9 UTSW 14 121580528 missense probably damaging 1.00
R9069:Dock9 UTSW 14 121628912 missense probably damaging 0.98
R9218:Dock9 UTSW 14 121668459 missense probably damaging 1.00
R9233:Dock9 UTSW 14 121583369 missense probably benign 0.09
R9236:Dock9 UTSW 14 121639558 missense probably damaging 1.00
R9285:Dock9 UTSW 14 121595600 missense probably benign
R9451:Dock9 UTSW 14 121550189 splice site probably benign
R9461:Dock9 UTSW 14 121605189 missense probably benign 0.05
R9484:Dock9 UTSW 14 121581432 missense probably damaging 1.00
R9517:Dock9 UTSW 14 121591824 missense probably benign 0.07
R9542:Dock9 UTSW 14 121627363 missense probably damaging 1.00
R9694:Dock9 UTSW 14 121581379 missense probably damaging 1.00
R9701:Dock9 UTSW 14 121639571 missense probably benign 0.01
R9703:Dock9 UTSW 14 121544577 makesense probably null
R9726:Dock9 UTSW 14 121597737 missense possibly damaging 0.61
R9741:Dock9 UTSW 14 121640104 missense probably damaging 1.00
Z1088:Dock9 UTSW 14 121555275 missense probably damaging 1.00
Z1176:Dock9 UTSW 14 121651782 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTCAGAGAGGCTCCAGGTGTG -3'
(R):5'- GAGGGAGTTCTTCTATCCTTCCTTG -3'

Sequencing Primer
(F):5'- TCCAGGTGTGGACAGACTG -3'
(R):5'- CATGGTAATGTGAACCTGTTGACCC -3'
Posted On 2021-08-02