Incidental Mutation 'R8895:Celsr2'
ID 677939
Institutional Source Beutler Lab
Gene Symbol Celsr2
Ensembl Gene ENSMUSG00000068740
Gene Name cadherin, EGF LAG seven-pass G-type receptor 2
Synonyms mfmi1, EGFL2, flamingo
MMRRC Submission
Accession Numbers

Genbank: NM_017392.3, NM_001004177.2 ; Ensembl: ENSMUST00000090558
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8895 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 108390851-108415552 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 108413564 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 644 (T644I)
Ref Sequence ENSEMBL: ENSMUSP00000088046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090558]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000090558
AA Change: T644I

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000088046
Gene: ENSMUSG00000068740
AA Change: T644I

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 35 53 N/A INTRINSIC
CA 203 287 1.36e-26 SMART
CA 311 397 1.33e-29 SMART
CA 421 503 2.59e-27 SMART
CA 527 608 3.33e-30 SMART
CA 632 710 5.18e-18 SMART
CA 734 813 1.08e-29 SMART
CA 837 919 8.08e-29 SMART
low complexity region 920 932 N/A INTRINSIC
CA 943 1021 4.3e-24 SMART
CA 1049 1125 1.87e-1 SMART
low complexity region 1188 1198 N/A INTRINSIC
EGF 1231 1286 1.81e-3 SMART
EGF_CA 1288 1324 2.24e-8 SMART
EGF 1331 1366 6.65e-2 SMART
LamG 1387 1554 8.4e-30 SMART
EGF 1577 1610 8e-5 SMART
LamG 1636 1770 1.56e-24 SMART
EGF 1796 1829 2.35e-2 SMART
EGF 1831 1867 3.88e-3 SMART
TNFR 1908 1943 1.35e-1 SMART
EGF_Lam 1924 1969 9.54e-12 SMART
HormR 1972 2034 1.57e-20 SMART
Pfam:GAIN 2046 2289 3e-62 PFAM
GPS 2315 2368 1.86e-25 SMART
Pfam:7tm_2 2373 2605 1.1e-48 PFAM
low complexity region 2715 2733 N/A INTRINSIC
low complexity region 2857 2873 N/A INTRINSIC
low complexity region 2874 2881 N/A INTRINSIC
Meta Mutation Damage Score 0.2140 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. The specific function of this particular member has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this allele have mild to moderately dilated lateral ventricles in the brain but are otherwise normal. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(3)
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik G A X: 70,394,388 R100W possibly damaging Het
4931409K22Rik T C 5: 24,550,630 D298G probably benign Het
5830411N06Rik C T 7: 140,261,619 P279S possibly damaging Het
Adamts10 G A 17: 33,549,296 R814H probably damaging Het
Akr1a1 A G 4: 116,641,063 L95P probably damaging Het
Amigo2 G T 15: 97,245,508 N344K probably damaging Het
Ankrd11 T C 8: 122,894,275 D946G possibly damaging Het
Btnl6 T G 17: 34,515,417 I124L probably benign Het
Bzw2 A T 12: 36,123,983 C97* probably null Het
Cep85l A T 10: 53,348,815 L226Q possibly damaging Het
Ces1g T C 8: 93,319,884 K338E possibly damaging Het
Cldn10 G A 14: 118,855,095 D36N probably damaging Het
Cntnap4 T A 8: 112,752,966 I261N probably benign Het
Csnk1g1 T C 9: 66,007,827 probably null Het
Cyp2c69 T C 19: 39,881,466 D104G possibly damaging Het
Cyp3a11 T C 5: 145,860,520 T350A probably benign Het
Daw1 T A 1: 83,209,290 C274S probably damaging Het
Dmtn T C 14: 70,612,704 T267A probably benign Het
Dock5 A G 14: 67,817,663 Y585H possibly damaging Het
Dsg2 T G 18: 20,590,069 V384G probably damaging Het
Elmo1 C T 13: 20,564,460 L492F probably damaging Het
Fam172a T A 13: 77,999,654 N280K probably damaging Het
Fmo1 T C 1: 162,830,258 D438G probably benign Het
Folr2 C T 7: 101,840,201 V244M unknown Het
Galnt18 T C 7: 111,779,502 I16V possibly damaging Het
Gm10036 C A 18: 15,833,150 Y119* probably null Het
Gm853 T C 4: 130,211,430 K316E probably benign Het
Gm884 T A 11: 103,618,830 T771S unknown Het
Gria4 A G 9: 4,664,951 S102P probably damaging Het
Hc A T 2: 35,000,849 N1318K probably benign Het
Ifitm1 T C 7: 140,969,586 L94P probably damaging Het
Itga9 G A 9: 118,681,767 V455M probably damaging Het
Kank4 C T 4: 98,765,510 V894I possibly damaging Het
Kcnip2 T A 19: 45,796,661 probably benign Het
Lamb1 A G 12: 31,302,954 T885A possibly damaging Het
Lamp5 A G 2: 136,060,954 T198A probably benign Het
Lipi A T 16: 75,555,822 L376I probably benign Het
Luc7l T C 17: 26,254,004 I31T possibly damaging Het
Malrd1 A T 2: 15,845,227 N1219I unknown Het
Mcf2l C T 8: 12,984,330 probably benign Het
Mrc1 A C 2: 14,307,949 N894T probably damaging Het
Mrpl35 C T 6: 71,816,287 A127T possibly damaging Het
Myom2 T A 8: 15,102,589 Y645* probably null Het
Naip2 T C 13: 100,189,136 H88R probably benign Het
Noc3l T A 19: 38,810,307 K282N probably damaging Het
Nwd2 T C 5: 63,805,898 Y942H probably damaging Het
Olfr1123 T C 2: 87,418,315 V87A probably benign Het
Olfr646 T A 7: 104,107,095 I272N probably damaging Het
Osbpl9 C A 4: 109,073,136 A221S probably benign Het
Paip1 T C 13: 119,430,265 L45S probably benign Het
Peak1 T C 9: 56,206,654 T1668A probably benign Het
Pgap3 A G 11: 98,390,776 F199L possibly damaging Het
Ppip5k2 T C 1: 97,711,819 M1061V probably benign Het
Ppp6r3 A T 19: 3,494,017 W333R probably damaging Het
Ptk2b T A 14: 66,174,793 N383I probably benign Het
Rab21 G C 10: 115,315,175 R58G probably benign Het
Rabif C T 1: 134,506,197 T83I probably damaging Het
Rdh7 A T 10: 127,888,561 F18Y probably benign Het
Sept5 A G 16: 18,623,111 M315T possibly damaging Het
Slc27a6 A G 18: 58,582,234 Y303C probably damaging Het
Slc7a7 T A 14: 54,369,836 M495L probably benign Het
Sntg1 T A 1: 8,677,850 probably null Het
Spred2 T A 11: 20,001,019 I72N probably benign Het
St3gal1 A T 15: 67,108,237 I271N possibly damaging Het
Stox1 A T 10: 62,659,607 H962Q probably benign Het
Supt6 A T 11: 78,212,838 M1347K probably damaging Het
Susd2 G T 10: 75,639,618 A484D possibly damaging Het
Tmem260 A G 14: 48,500,388 probably benign Het
Tpbg C A 9: 85,844,467 A163E possibly damaging Het
Tpx2 T C 2: 152,882,335 Y344H probably damaging Het
Ttf2 A T 3: 100,962,712 F348L probably benign Het
Ttn A T 2: 76,833,306 V11675E unknown Het
Txnl4b T A 8: 109,572,835 Y142* probably null Het
Vmn2r18 G A 5: 151,561,675 R785C possibly damaging Het
Zbtb18 T A 1: 177,448,478 V459E probably damaging Het
Other mutations in Celsr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Celsr2 APN 3 108413879 missense possibly damaging 0.49
IGL01020:Celsr2 APN 3 108403270 missense probably damaging 0.99
IGL01420:Celsr2 APN 3 108393763 missense probably benign 0.13
IGL01448:Celsr2 APN 3 108393239 missense probably damaging 0.99
IGL01559:Celsr2 APN 3 108406867 missense possibly damaging 0.75
IGL01674:Celsr2 APN 3 108414843 missense probably damaging 1.00
IGL01863:Celsr2 APN 3 108394022 missense probably benign 0.00
IGL02309:Celsr2 APN 3 108396011 missense probably damaging 1.00
IGL02325:Celsr2 APN 3 108412871 missense probably damaging 1.00
IGL02409:Celsr2 APN 3 108413955 missense probably damaging 1.00
IGL02514:Celsr2 APN 3 108397510 missense probably benign 0.01
IGL02812:Celsr2 APN 3 108414113 missense probably benign 0.25
IGL02894:Celsr2 APN 3 108395210 missense probably damaging 1.00
IGL03281:Celsr2 APN 3 108412940 missense probably damaging 1.00
barrow UTSW 3 108394965 missense possibly damaging 0.92
goldeneye UTSW 3 108394919 missense probably damaging 1.00
1mM(1):Celsr2 UTSW 3 108400838 missense probably benign 0.01
ANU74:Celsr2 UTSW 3 108412499 missense probably damaging 1.00
IGL02799:Celsr2 UTSW 3 108414062 missense probably damaging 1.00
R0011:Celsr2 UTSW 3 108413402 missense probably benign 0.19
R0031:Celsr2 UTSW 3 108413063 missense probably damaging 1.00
R0049:Celsr2 UTSW 3 108397254 missense probably benign 0.12
R0049:Celsr2 UTSW 3 108397254 missense probably benign 0.12
R0090:Celsr2 UTSW 3 108393327 splice site probably benign
R0140:Celsr2 UTSW 3 108397933 missense probably benign 0.00
R0524:Celsr2 UTSW 3 108401587 missense probably damaging 1.00
R0607:Celsr2 UTSW 3 108403895 critical splice donor site probably null
R0662:Celsr2 UTSW 3 108398520 missense probably damaging 0.99
R0690:Celsr2 UTSW 3 108414977 missense probably damaging 1.00
R0691:Celsr2 UTSW 3 108412623 missense probably damaging 1.00
R0710:Celsr2 UTSW 3 108412712 missense probably benign 0.42
R0730:Celsr2 UTSW 3 108398606 missense probably damaging 1.00
R0815:Celsr2 UTSW 3 108401301 missense possibly damaging 0.56
R0848:Celsr2 UTSW 3 108414338 missense probably benign
R0989:Celsr2 UTSW 3 108403272 missense probably benign 0.00
R1185:Celsr2 UTSW 3 108399709 missense possibly damaging 0.95
R1185:Celsr2 UTSW 3 108399709 missense possibly damaging 0.95
R1185:Celsr2 UTSW 3 108399709 missense possibly damaging 0.95
R1469:Celsr2 UTSW 3 108414108 missense probably damaging 1.00
R1469:Celsr2 UTSW 3 108414108 missense probably damaging 1.00
R1474:Celsr2 UTSW 3 108393739 missense possibly damaging 0.91
R1608:Celsr2 UTSW 3 108402483 missense probably damaging 1.00
R1653:Celsr2 UTSW 3 108413520 missense possibly damaging 0.52
R1659:Celsr2 UTSW 3 108414095 missense probably benign
R1689:Celsr2 UTSW 3 108407304 missense possibly damaging 0.63
R1848:Celsr2 UTSW 3 108401310 missense probably benign 0.35
R1859:Celsr2 UTSW 3 108396630 missense probably damaging 1.00
R1918:Celsr2 UTSW 3 108398650 missense probably benign 0.05
R1974:Celsr2 UTSW 3 108414214 missense probably damaging 1.00
R2042:Celsr2 UTSW 3 108402495 missense probably damaging 0.98
R2167:Celsr2 UTSW 3 108413193 missense probably damaging 0.96
R2333:Celsr2 UTSW 3 108398605 missense probably benign 0.16
R2434:Celsr2 UTSW 3 108404479 missense probably damaging 1.00
R2504:Celsr2 UTSW 3 108413591 missense probably benign 0.11
R3420:Celsr2 UTSW 3 108414416 missense probably benign 0.03
R3712:Celsr2 UTSW 3 108400839 missense probably benign
R3723:Celsr2 UTSW 3 108397415 splice site probably benign
R3809:Celsr2 UTSW 3 108403239 missense possibly damaging 0.67
R4018:Celsr2 UTSW 3 108394965 missense possibly damaging 0.92
R4126:Celsr2 UTSW 3 108402097 missense possibly damaging 0.71
R4177:Celsr2 UTSW 3 108413978 missense probably damaging 0.96
R4232:Celsr2 UTSW 3 108413772 missense probably benign 0.02
R4293:Celsr2 UTSW 3 108393677 missense probably benign 0.01
R4458:Celsr2 UTSW 3 108394997 missense probably damaging 0.98
R4621:Celsr2 UTSW 3 108395216 missense possibly damaging 0.86
R4645:Celsr2 UTSW 3 108395969 missense probably damaging 1.00
R4700:Celsr2 UTSW 3 108397231 missense probably benign 0.24
R4732:Celsr2 UTSW 3 108398952 missense probably damaging 0.99
R4733:Celsr2 UTSW 3 108398952 missense probably damaging 0.99
R4901:Celsr2 UTSW 3 108406987 missense possibly damaging 0.81
R4932:Celsr2 UTSW 3 108402758 missense probably damaging 1.00
R4989:Celsr2 UTSW 3 108412629 missense possibly damaging 0.62
R5052:Celsr2 UTSW 3 108412358 missense probably damaging 1.00
R5093:Celsr2 UTSW 3 108413373 missense possibly damaging 0.66
R5114:Celsr2 UTSW 3 108393996 missense probably benign 0.05
R5120:Celsr2 UTSW 3 108393120 missense probably benign 0.02
R5135:Celsr2 UTSW 3 108398659 missense probably damaging 1.00
R5247:Celsr2 UTSW 3 108397630 missense probably benign 0.34
R5381:Celsr2 UTSW 3 108402757 missense probably damaging 1.00
R5412:Celsr2 UTSW 3 108399995 missense probably damaging 1.00
R5445:Celsr2 UTSW 3 108392658 missense probably benign 0.01
R5528:Celsr2 UTSW 3 108413294 missense probably damaging 1.00
R5598:Celsr2 UTSW 3 108402803 missense possibly damaging 0.82
R5652:Celsr2 UTSW 3 108396735 missense probably null 0.49
R5697:Celsr2 UTSW 3 108403921 nonsense probably null
R5718:Celsr2 UTSW 3 108393358 missense probably benign
R5869:Celsr2 UTSW 3 108413909 missense probably damaging 1.00
R5876:Celsr2 UTSW 3 108413943 missense probably damaging 0.96
R6021:Celsr2 UTSW 3 108401245 missense probably benign
R6054:Celsr2 UTSW 3 108406963 missense possibly damaging 0.95
R6244:Celsr2 UTSW 3 108393128 missense probably damaging 0.96
R6313:Celsr2 UTSW 3 108401214 missense probably damaging 0.99
R6322:Celsr2 UTSW 3 108412574 missense probably damaging 1.00
R6555:Celsr2 UTSW 3 108394919 missense probably damaging 1.00
R6682:Celsr2 UTSW 3 108400501 critical splice donor site probably null
R7062:Celsr2 UTSW 3 108402510 missense possibly damaging 0.95
R7110:Celsr2 UTSW 3 108397865 missense probably damaging 1.00
R7139:Celsr2 UTSW 3 108415359 missense unknown
R7326:Celsr2 UTSW 3 108394995 missense possibly damaging 0.85
R7425:Celsr2 UTSW 3 108402457 missense probably damaging 1.00
R7452:Celsr2 UTSW 3 108413090 missense possibly damaging 0.95
R7461:Celsr2 UTSW 3 108395640 missense probably damaging 1.00
R7502:Celsr2 UTSW 3 108398902 missense probably benign 0.00
R7613:Celsr2 UTSW 3 108395640 missense probably damaging 1.00
R7644:Celsr2 UTSW 3 108413490 missense probably damaging 0.99
R7666:Celsr2 UTSW 3 108398588 missense probably benign
R7687:Celsr2 UTSW 3 108397769 missense probably benign 0.27
R7695:Celsr2 UTSW 3 108402753 missense probably damaging 1.00
R8002:Celsr2 UTSW 3 108403969 missense probably damaging 1.00
R8052:Celsr2 UTSW 3 108412655 missense probably damaging 1.00
R8283:Celsr2 UTSW 3 108396455 missense probably damaging 1.00
R8356:Celsr2 UTSW 3 108413531 missense possibly damaging 0.90
R8381:Celsr2 UTSW 3 108395636 missense probably damaging 1.00
R8427:Celsr2 UTSW 3 108392633 makesense probably null
R8435:Celsr2 UTSW 3 108414399 missense probably benign
R8438:Celsr2 UTSW 3 108393823 missense probably damaging 1.00
R8458:Celsr2 UTSW 3 108398902 missense probably benign 0.00
R8460:Celsr2 UTSW 3 108396777 missense possibly damaging 0.84
R8462:Celsr2 UTSW 3 108412851 nonsense probably null
R8479:Celsr2 UTSW 3 108398902 missense probably benign 0.00
R8480:Celsr2 UTSW 3 108398902 missense probably benign 0.00
R8512:Celsr2 UTSW 3 108413838 missense probably damaging 1.00
R8694:Celsr2 UTSW 3 108406860 missense probably damaging 1.00
R8772:Celsr2 UTSW 3 108397073 missense possibly damaging 0.84
R8843:Celsr2 UTSW 3 108396127 splice site probably benign
R8888:Celsr2 UTSW 3 108413564 missense possibly damaging 0.95
R8917:Celsr2 UTSW 3 108396566 missense probably benign 0.00
R9119:Celsr2 UTSW 3 108401972 missense possibly damaging 0.90
R9169:Celsr2 UTSW 3 108402546 missense probably benign 0.04
R9209:Celsr2 UTSW 3 108414033 missense probably benign 0.02
R9342:Celsr2 UTSW 3 108413126 missense probably damaging 1.00
R9416:Celsr2 UTSW 3 108414768 missense probably damaging 0.96
R9493:Celsr2 UTSW 3 108393758 missense probably damaging 1.00
R9564:Celsr2 UTSW 3 108414518 missense probably damaging 1.00
R9598:Celsr2 UTSW 3 108415262 missense possibly damaging 0.72
R9629:Celsr2 UTSW 3 108401599 missense probably damaging 1.00
R9691:Celsr2 UTSW 3 108394235 missense probably damaging 1.00
X0020:Celsr2 UTSW 3 108396110 missense probably damaging 1.00
X0050:Celsr2 UTSW 3 108401272 missense probably benign 0.09
Z1088:Celsr2 UTSW 3 108414117 missense probably damaging 1.00
Z1176:Celsr2 UTSW 3 108393131 missense probably benign 0.10
Z1176:Celsr2 UTSW 3 108412341 missense probably benign 0.07
Z1177:Celsr2 UTSW 3 108412220 missense probably damaging 1.00
Z1177:Celsr2 UTSW 3 108413571 missense probably benign 0.32
Z1191:Celsr2 UTSW 3 108414549 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GTTGGCATCGGTGACATTCAC -3'
(R):5'- GGGAAGAGGTTGATTTCTACAGC -3'

Sequencing Primer
(F):5'- GACATTCACTACTATCTGAGCTGTG -3'
(R):5'- ACAGCTTTGGTGTAGAGGCCC -3'
Posted On 2021-08-02