Incidental Mutation 'R8895:Gria4'
ID 677960
Institutional Source Beutler Lab
Gene Symbol Gria4
Ensembl Gene ENSMUSG00000025892
Gene Name glutamate receptor, ionotropic, AMPA4 (alpha 4)
Synonyms Gluralpha4, spkw1, Glur4, Glur-4
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.805) question?
Stock # R8895 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 4417896-4796234 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 4664951 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 102 (S102P)
Ref Sequence ENSEMBL: ENSMUSP00000066980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000163309] [ENSMUST00000212533]
AlphaFold Q9Z2W8
Predicted Effect probably damaging
Transcript: ENSMUST00000027020
AA Change: S102P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892
AA Change: S102P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 3e-61 PFAM
PBPe 416 791 8.23e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000063508
AA Change: S102P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892
AA Change: S102P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 2.5e-71 PFAM
PBPe 416 791 2.06e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163309
AA Change: S102P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129316
Gene: ENSMUSG00000025892
AA Change: S102P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 3.2e-62 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212533
AA Change: S102P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik G A X: 70,394,388 R100W possibly damaging Het
4931409K22Rik T C 5: 24,550,630 D298G probably benign Het
5830411N06Rik C T 7: 140,261,619 P279S possibly damaging Het
Adamts10 G A 17: 33,549,296 R814H probably damaging Het
Akr1a1 A G 4: 116,641,063 L95P probably damaging Het
Amigo2 G T 15: 97,245,508 N344K probably damaging Het
Ankrd11 T C 8: 122,894,275 D946G possibly damaging Het
Btnl6 T G 17: 34,515,417 I124L probably benign Het
Bzw2 A T 12: 36,123,983 C97* probably null Het
Celsr2 G A 3: 108,413,564 T644I possibly damaging Het
Cep85l A T 10: 53,348,815 L226Q possibly damaging Het
Ces1g T C 8: 93,319,884 K338E possibly damaging Het
Cldn10 G A 14: 118,855,095 D36N probably damaging Het
Cntnap4 T A 8: 112,752,966 I261N probably benign Het
Csnk1g1 T C 9: 66,007,827 probably null Het
Cyp2c69 T C 19: 39,881,466 D104G possibly damaging Het
Cyp3a11 T C 5: 145,860,520 T350A probably benign Het
Daw1 T A 1: 83,209,290 C274S probably damaging Het
Dmtn T C 14: 70,612,704 T267A probably benign Het
Dock5 A G 14: 67,817,663 Y585H possibly damaging Het
Dsg2 T G 18: 20,590,069 V384G probably damaging Het
Elmo1 C T 13: 20,564,460 L492F probably damaging Het
Fam172a T A 13: 77,999,654 N280K probably damaging Het
Fmo1 T C 1: 162,830,258 D438G probably benign Het
Folr2 C T 7: 101,840,201 V244M unknown Het
Galnt18 T C 7: 111,779,502 I16V possibly damaging Het
Gm10036 C A 18: 15,833,150 Y119* probably null Het
Gm853 T C 4: 130,211,430 K316E probably benign Het
Gm884 T A 11: 103,618,830 T771S unknown Het
Hc A T 2: 35,000,849 N1318K probably benign Het
Ifitm1 T C 7: 140,969,586 L94P probably damaging Het
Itga9 G A 9: 118,681,767 V455M probably damaging Het
Kank4 C T 4: 98,765,510 V894I possibly damaging Het
Kcnip2 T A 19: 45,796,661 probably benign Het
Lamb1 A G 12: 31,302,954 T885A possibly damaging Het
Lamp5 A G 2: 136,060,954 T198A probably benign Het
Lipi A T 16: 75,555,822 L376I probably benign Het
Luc7l T C 17: 26,254,004 I31T possibly damaging Het
Malrd1 A T 2: 15,845,227 N1219I unknown Het
Mcf2l C T 8: 12,984,330 probably benign Het
Mrc1 A C 2: 14,307,949 N894T probably damaging Het
Mrpl35 C T 6: 71,816,287 A127T possibly damaging Het
Myom2 T A 8: 15,102,589 Y645* probably null Het
Naip2 T C 13: 100,189,136 H88R probably benign Het
Noc3l T A 19: 38,810,307 K282N probably damaging Het
Nwd2 T C 5: 63,805,898 Y942H probably damaging Het
Olfr1123 T C 2: 87,418,315 V87A probably benign Het
Olfr646 T A 7: 104,107,095 I272N probably damaging Het
Osbpl9 C A 4: 109,073,136 A221S probably benign Het
Paip1 T C 13: 119,430,265 L45S probably benign Het
Peak1 T C 9: 56,206,654 T1668A probably benign Het
Pgap3 A G 11: 98,390,776 F199L possibly damaging Het
Ppip5k2 T C 1: 97,711,819 M1061V probably benign Het
Ppp6r3 A T 19: 3,494,017 W333R probably damaging Het
Ptk2b T A 14: 66,174,793 N383I probably benign Het
Rab21 G C 10: 115,315,175 R58G probably benign Het
Rabif C T 1: 134,506,197 T83I probably damaging Het
Rdh7 A T 10: 127,888,561 F18Y probably benign Het
Sept5 A G 16: 18,623,111 M315T possibly damaging Het
Slc27a6 A G 18: 58,582,234 Y303C probably damaging Het
Slc7a7 T A 14: 54,369,836 M495L probably benign Het
Sntg1 T A 1: 8,677,850 probably null Het
Spred2 T A 11: 20,001,019 I72N probably benign Het
St3gal1 A T 15: 67,108,237 I271N possibly damaging Het
Stox1 A T 10: 62,659,607 H962Q probably benign Het
Supt6 A T 11: 78,212,838 M1347K probably damaging Het
Susd2 G T 10: 75,639,618 A484D possibly damaging Het
Tmem260 A G 14: 48,500,388 probably benign Het
Tpbg C A 9: 85,844,467 A163E possibly damaging Het
Tpx2 T C 2: 152,882,335 Y344H probably damaging Het
Ttf2 A T 3: 100,962,712 F348L probably benign Het
Ttn A T 2: 76,833,306 V11675E unknown Het
Txnl4b T A 8: 109,572,835 Y142* probably null Het
Vmn2r18 G A 5: 151,561,675 R785C possibly damaging Het
Zbtb18 T A 1: 177,448,478 V459E probably damaging Het
Other mutations in Gria4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Gria4 APN 9 4472202 missense probably damaging 0.98
IGL01451:Gria4 APN 9 4503652 missense probably benign 0.04
IGL01533:Gria4 APN 9 4502395 missense probably damaging 1.00
IGL01994:Gria4 APN 9 4537726 missense probably damaging 1.00
IGL02078:Gria4 APN 9 4793878 missense probably damaging 0.98
IGL02183:Gria4 APN 9 4502460 missense probably damaging 1.00
IGL02351:Gria4 APN 9 4456206 missense possibly damaging 0.84
IGL02358:Gria4 APN 9 4456206 missense possibly damaging 0.84
IGL03118:Gria4 APN 9 4793804 splice site probably benign
IGL03131:Gria4 APN 9 4432876 missense probably damaging 0.96
IGL03148:Gria4 APN 9 4464295 missense possibly damaging 0.91
IGL03264:Gria4 APN 9 4513288 missense probably benign
PIT4812001:Gria4 UTSW 9 4427128 missense probably damaging 1.00
R0018:Gria4 UTSW 9 4432843 missense possibly damaging 0.71
R0295:Gria4 UTSW 9 4793840 missense possibly damaging 0.69
R0654:Gria4 UTSW 9 4464372 missense probably benign 0.32
R0690:Gria4 UTSW 9 4427071 missense probably damaging 1.00
R0992:Gria4 UTSW 9 4795238 missense probably benign
R1517:Gria4 UTSW 9 4793865 missense probably damaging 1.00
R1673:Gria4 UTSW 9 4537637 nonsense probably null
R1713:Gria4 UTSW 9 4424448 missense probably benign 0.20
R1961:Gria4 UTSW 9 4519546 splice site probably benign
R2137:Gria4 UTSW 9 4427026 intron probably benign
R2397:Gria4 UTSW 9 4537717 missense probably damaging 1.00
R2870:Gria4 UTSW 9 4503614 missense probably damaging 0.96
R2870:Gria4 UTSW 9 4503614 missense probably damaging 0.96
R3014:Gria4 UTSW 9 4464294 missense probably damaging 0.97
R3412:Gria4 UTSW 9 4513278 missense probably benign 0.00
R3732:Gria4 UTSW 9 4513295 missense probably benign
R3732:Gria4 UTSW 9 4513295 missense probably benign
R3733:Gria4 UTSW 9 4513295 missense probably benign
R3897:Gria4 UTSW 9 4513260 missense probably damaging 1.00
R4404:Gria4 UTSW 9 4464489 splice site probably null
R4457:Gria4 UTSW 9 4427074 missense probably damaging 1.00
R4672:Gria4 UTSW 9 4664981 missense possibly damaging 0.96
R4865:Gria4 UTSW 9 4464295 missense possibly damaging 0.91
R5092:Gria4 UTSW 9 4472176 missense probably benign 0.01
R5109:Gria4 UTSW 9 4472168 missense probably damaging 1.00
R5202:Gria4 UTSW 9 4424330 missense probably benign 0.10
R5828:Gria4 UTSW 9 4432832 missense probably damaging 1.00
R5945:Gria4 UTSW 9 4456122 missense probably damaging 1.00
R5985:Gria4 UTSW 9 4503593 missense probably damaging 0.99
R6036:Gria4 UTSW 9 4537646 missense probably benign 0.00
R6036:Gria4 UTSW 9 4537646 missense probably benign 0.00
R6111:Gria4 UTSW 9 4502430 missense probably damaging 1.00
R6190:Gria4 UTSW 9 4420199 missense probably benign
R6280:Gria4 UTSW 9 4456072 missense probably damaging 1.00
R6406:Gria4 UTSW 9 4427077 missense probably damaging 1.00
R6470:Gria4 UTSW 9 4503680 missense probably damaging 1.00
R6485:Gria4 UTSW 9 4464249 missense probably damaging 1.00
R6612:Gria4 UTSW 9 4472206 missense possibly damaging 0.93
R6848:Gria4 UTSW 9 4793822 missense probably damaging 1.00
R7046:Gria4 UTSW 9 4420278 missense probably damaging 0.97
R7210:Gria4 UTSW 9 4464135 missense probably damaging 1.00
R7284:Gria4 UTSW 9 4472017 missense probably damaging 1.00
R7475:Gria4 UTSW 9 4513330 missense probably damaging 1.00
R7501:Gria4 UTSW 9 4502436 missense probably benign 0.01
R7536:Gria4 UTSW 9 4464298 missense probably damaging 1.00
R7604:Gria4 UTSW 9 4464315 missense probably damaging 1.00
R7643:Gria4 UTSW 9 4793950 missense probably benign 0.00
R7669:Gria4 UTSW 9 4462029 missense probably damaging 1.00
R7703:Gria4 UTSW 9 4503588 missense probably benign
R7720:Gria4 UTSW 9 4464288 missense probably damaging 1.00
R7724:Gria4 UTSW 9 4472074 missense probably damaging 1.00
R7909:Gria4 UTSW 9 4464450 missense probably damaging 1.00
R8007:Gria4 UTSW 9 4503740 splice site probably benign
R8044:Gria4 UTSW 9 4456216 missense probably damaging 1.00
R8062:Gria4 UTSW 9 4480273 missense possibly damaging 0.54
R8131:Gria4 UTSW 9 4502429 missense probably benign 0.16
R8212:Gria4 UTSW 9 4480242 missense probably benign
R8478:Gria4 UTSW 9 4793882 missense probably damaging 1.00
R8699:Gria4 UTSW 9 4424347 missense probably damaging 1.00
R8699:Gria4 UTSW 9 4424351 missense probably damaging 1.00
R8785:Gria4 UTSW 9 4456106 missense probably damaging 1.00
R8785:Gria4 UTSW 9 4795189 missense possibly damaging 0.92
R8888:Gria4 UTSW 9 4664951 missense probably damaging 1.00
R9160:Gria4 UTSW 9 4424412 missense probably damaging 1.00
X0023:Gria4 UTSW 9 4427067 missense probably damaging 1.00
X0065:Gria4 UTSW 9 4464340 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AGACTTACCCCTGTCTGTATCATAC -3'
(R):5'- TGTCAGCACAAACTCAAGAACTTAG -3'

Sequencing Primer
(F):5'- TACAGGAAGACAAAACAATTCCATTC -3'
(R):5'- GCAGTTTCACAATGGGGT -3'
Posted On 2021-08-02