Incidental Mutation 'R8895:Naip2'
ID 677978
Institutional Source Beutler Lab
Gene Symbol Naip2
Ensembl Gene ENSMUSG00000078945
Gene Name NLR family, apoptosis inhibitory protein 2
Synonyms Birc1b, Naip2, Naip-rs6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock # R8895 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 100144063-100202092 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100189136 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 88 (H88R)
Ref Sequence ENSEMBL: ENSMUSP00000070827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067975] [ENSMUST00000117913] [ENSMUST00000167986]
AlphaFold Q9QUK4
Predicted Effect probably benign
Transcript: ENSMUST00000067975
AA Change: H88R

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000070827
Gene: ENSMUSG00000078945
AA Change: H88R

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 1.9e-36 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117913
AA Change: H88R

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000113890
Gene: ENSMUSG00000078945
AA Change: H88R

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 1.9e-36 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000167986
AA Change: H88R

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125852
Gene: ENSMUSG00000078945
AA Change: H88R

DomainStartEndE-ValueType
BIR 58 129 7.95e-18 SMART
BIR 157 229 5.31e-37 SMART
BIR 276 347 4.22e-31 SMART
Pfam:NACHT 508 662 8.6e-35 PFAM
low complexity region 954 964 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. This copy of the gene is full length; additional copies with truncations and internal deletions are also present in this region of chromosome 5q13. It is thought that this gene is a modifier of spinal muscular atrophy caused by mutations in a neighboring gene, SMN1. The protein encoded by this gene contains regions of homology to two baculovirus inhibitor of apoptosis proteins, and it is able to suppress apoptosis induced by various signals. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik G A X: 70,394,388 R100W possibly damaging Het
4931409K22Rik T C 5: 24,550,630 D298G probably benign Het
5830411N06Rik C T 7: 140,261,619 P279S possibly damaging Het
Adamts10 G A 17: 33,549,296 R814H probably damaging Het
Akr1a1 A G 4: 116,641,063 L95P probably damaging Het
Amigo2 G T 15: 97,245,508 N344K probably damaging Het
Ankrd11 T C 8: 122,894,275 D946G possibly damaging Het
Btnl6 T G 17: 34,515,417 I124L probably benign Het
Bzw2 A T 12: 36,123,983 C97* probably null Het
Celsr2 G A 3: 108,413,564 T644I possibly damaging Het
Cep85l A T 10: 53,348,815 L226Q possibly damaging Het
Ces1g T C 8: 93,319,884 K338E possibly damaging Het
Cldn10 G A 14: 118,855,095 D36N probably damaging Het
Cntnap4 T A 8: 112,752,966 I261N probably benign Het
Csnk1g1 T C 9: 66,007,827 probably null Het
Cyp2c69 T C 19: 39,881,466 D104G possibly damaging Het
Cyp3a11 T C 5: 145,860,520 T350A probably benign Het
Daw1 T A 1: 83,209,290 C274S probably damaging Het
Dmtn T C 14: 70,612,704 T267A probably benign Het
Dock5 A G 14: 67,817,663 Y585H possibly damaging Het
Dsg2 T G 18: 20,590,069 V384G probably damaging Het
Elmo1 C T 13: 20,564,460 L492F probably damaging Het
Fam172a T A 13: 77,999,654 N280K probably damaging Het
Fmo1 T C 1: 162,830,258 D438G probably benign Het
Folr2 C T 7: 101,840,201 V244M unknown Het
Galnt18 T C 7: 111,779,502 I16V possibly damaging Het
Gm10036 C A 18: 15,833,150 Y119* probably null Het
Gm853 T C 4: 130,211,430 K316E probably benign Het
Gm884 T A 11: 103,618,830 T771S unknown Het
Gria4 A G 9: 4,664,951 S102P probably damaging Het
Hc A T 2: 35,000,849 N1318K probably benign Het
Ifitm1 T C 7: 140,969,586 L94P probably damaging Het
Itga9 G A 9: 118,681,767 V455M probably damaging Het
Kank4 C T 4: 98,765,510 V894I possibly damaging Het
Kcnip2 T A 19: 45,796,661 probably benign Het
Lamb1 A G 12: 31,302,954 T885A possibly damaging Het
Lamp5 A G 2: 136,060,954 T198A probably benign Het
Lipi A T 16: 75,555,822 L376I probably benign Het
Luc7l T C 17: 26,254,004 I31T possibly damaging Het
Malrd1 A T 2: 15,845,227 N1219I unknown Het
Mcf2l C T 8: 12,984,330 probably benign Het
Mrc1 A C 2: 14,307,949 N894T probably damaging Het
Mrpl35 C T 6: 71,816,287 A127T possibly damaging Het
Myom2 T A 8: 15,102,589 Y645* probably null Het
Noc3l T A 19: 38,810,307 K282N probably damaging Het
Nwd2 T C 5: 63,805,898 Y942H probably damaging Het
Olfr1123 T C 2: 87,418,315 V87A probably benign Het
Olfr646 T A 7: 104,107,095 I272N probably damaging Het
Osbpl9 C A 4: 109,073,136 A221S probably benign Het
Paip1 T C 13: 119,430,265 L45S probably benign Het
Peak1 T C 9: 56,206,654 T1668A probably benign Het
Pgap3 A G 11: 98,390,776 F199L possibly damaging Het
Ppip5k2 T C 1: 97,711,819 M1061V probably benign Het
Ppp6r3 A T 19: 3,494,017 W333R probably damaging Het
Ptk2b T A 14: 66,174,793 N383I probably benign Het
Rab21 G C 10: 115,315,175 R58G probably benign Het
Rabif C T 1: 134,506,197 T83I probably damaging Het
Rdh7 A T 10: 127,888,561 F18Y probably benign Het
Sept5 A G 16: 18,623,111 M315T possibly damaging Het
Slc27a6 A G 18: 58,582,234 Y303C probably damaging Het
Slc7a7 T A 14: 54,369,836 M495L probably benign Het
Sntg1 T A 1: 8,677,850 probably null Het
Spred2 T A 11: 20,001,019 I72N probably benign Het
St3gal1 A T 15: 67,108,237 I271N possibly damaging Het
Stox1 A T 10: 62,659,607 H962Q probably benign Het
Supt6 A T 11: 78,212,838 M1347K probably damaging Het
Susd2 G T 10: 75,639,618 A484D possibly damaging Het
Tmem260 A G 14: 48,500,388 probably benign Het
Tpbg C A 9: 85,844,467 A163E possibly damaging Het
Tpx2 T C 2: 152,882,335 Y344H probably damaging Het
Ttf2 A T 3: 100,962,712 F348L probably benign Het
Ttn A T 2: 76,833,306 V11675E unknown Het
Txnl4b T A 8: 109,572,835 Y142* probably null Het
Vmn2r18 G A 5: 151,561,675 R785C possibly damaging Het
Zbtb18 T A 1: 177,448,478 V459E probably damaging Het
Other mutations in Naip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Naip2 APN 13 100154887 missense probably benign 0.00
IGL00676:Naip2 APN 13 100152632 missense probably damaging 1.00
IGL00870:Naip2 APN 13 100152060 splice site probably benign
IGL00908:Naip2 APN 13 100160649 missense probably benign 0.01
IGL00916:Naip2 APN 13 100161431 missense probably damaging 0.97
IGL00949:Naip2 APN 13 100161591 missense probably damaging 1.00
IGL01010:Naip2 APN 13 100154938 missense probably damaging 0.99
IGL01642:Naip2 APN 13 100160937 missense probably damaging 0.97
IGL01884:Naip2 APN 13 100188821 splice site probably benign
IGL01917:Naip2 APN 13 100162083 missense probably benign 0.00
IGL02015:Naip2 APN 13 100161607 missense possibly damaging 0.57
IGL02315:Naip2 APN 13 100161236 missense probably damaging 1.00
IGL02328:Naip2 APN 13 100161369 missense probably damaging 1.00
IGL02735:Naip2 APN 13 100160214 missense probably damaging 0.99
IGL02738:Naip2 APN 13 100189177 missense probably benign 0.01
IGL02887:Naip2 APN 13 100161512 missense possibly damaging 0.90
IGL02894:Naip2 APN 13 100160997 missense probably damaging 1.00
IGL02894:Naip2 APN 13 100183789 missense probably benign
IGL02974:Naip2 APN 13 100161678 missense probably damaging 1.00
IGL03024:Naip2 APN 13 100189354 missense possibly damaging 0.50
IGL03056:Naip2 APN 13 100162287 missense possibly damaging 0.90
IGL03281:Naip2 APN 13 100161620 missense probably damaging 0.99
R0131:Naip2 UTSW 13 100183788 missense probably benign 0.01
R0131:Naip2 UTSW 13 100183788 missense probably benign 0.01
R0132:Naip2 UTSW 13 100183788 missense probably benign 0.01
R0310:Naip2 UTSW 13 100148842 missense probably damaging 1.00
R0367:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0368:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0422:Naip2 UTSW 13 100161113 missense probably benign 0.10
R0441:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0445:Naip2 UTSW 13 100161887 missense possibly damaging 0.91
R0446:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0464:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0466:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0467:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0486:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0533:Naip2 UTSW 13 100161782 missense probably benign 0.01
R0853:Naip2 UTSW 13 100161854 missense probably benign
R0853:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0855:Naip2 UTSW 13 100161854 missense probably benign
R0855:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0904:Naip2 UTSW 13 100161854 missense probably benign
R0904:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0906:Naip2 UTSW 13 100161854 missense probably benign
R0906:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0908:Naip2 UTSW 13 100161854 missense probably benign
R0908:Naip2 UTSW 13 100161860 missense probably benign 0.00
R0959:Naip2 UTSW 13 100154878 missense probably benign 0.01
R0959:Naip2 UTSW 13 100154911 missense probably benign 0.03
R0962:Naip2 UTSW 13 100179385 missense probably damaging 1.00
R1024:Naip2 UTSW 13 100161854 missense probably benign
R1024:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1186:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1186:Naip2 UTSW 13 100162037 frame shift probably null
R1217:Naip2 UTSW 13 100161854 missense probably benign
R1217:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1340:Naip2 UTSW 13 100189122 missense possibly damaging 0.80
R1342:Naip2 UTSW 13 100161854 missense probably benign
R1342:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1404:Naip2 UTSW 13 100161854 missense probably benign
R1423:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1423:Naip2 UTSW 13 100154847 intron probably benign
R1423:Naip2 UTSW 13 100154872 missense possibly damaging 0.59
R1423:Naip2 UTSW 13 100154878 missense probably benign 0.01
R1426:Naip2 UTSW 13 100161854 missense probably benign
R1426:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1472:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1575:Naip2 UTSW 13 100155021 missense probably benign 0.00
R1575:Naip2 UTSW 13 100155029 intron probably benign
R1576:Naip2 UTSW 13 100155021 missense probably benign 0.00
R1576:Naip2 UTSW 13 100155029 intron probably benign
R1599:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1640:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1641:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1642:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1643:Naip2 UTSW 13 100161981 missense possibly damaging 0.63
R1644:Naip2 UTSW 13 100182929 missense possibly damaging 0.83
R1681:Naip2 UTSW 13 100161854 missense probably benign
R1681:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1891:Naip2 UTSW 13 100154887 missense probably benign 0.00
R1913:Naip2 UTSW 13 100152157 critical splice acceptor site probably null
R1937:Naip2 UTSW 13 100161854 missense probably benign
R1937:Naip2 UTSW 13 100161860 missense probably benign 0.00
R1993:Naip2 UTSW 13 100162007 missense probably benign 0.03
R2001:Naip2 UTSW 13 100144588 missense probably damaging 1.00
R2055:Naip2 UTSW 13 100179372 missense probably benign 0.07
R2198:Naip2 UTSW 13 100152592 missense probably damaging 1.00
R2906:Naip2 UTSW 13 100161996 missense probably damaging 1.00
R2931:Naip2 UTSW 13 100155021 missense probably benign 0.00
R3014:Naip2 UTSW 13 100161782 missense probably benign 0.01
R3016:Naip2 UTSW 13 100161782 missense probably benign 0.01
R3037:Naip2 UTSW 13 100154949 missense probably benign 0.08
R3414:Naip2 UTSW 13 100189263 nonsense probably null
R3437:Naip2 UTSW 13 100154911 missense probably benign 0.03
R3713:Naip2 UTSW 13 100161902 missense probably damaging 1.00
R3806:Naip2 UTSW 13 100152634 missense possibly damaging 0.92
R3847:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3847:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3848:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3848:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3849:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3849:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3850:Naip2 UTSW 13 100179432 missense probably damaging 1.00
R3850:Naip2 UTSW 13 100179433 missense probably damaging 1.00
R3891:Naip2 UTSW 13 100161098 missense probably damaging 0.99
R4419:Naip2 UTSW 13 100160625 missense probably benign 0.03
R4456:Naip2 UTSW 13 100154911 missense probably benign 0.03
R4458:Naip2 UTSW 13 100154911 missense probably benign 0.03
R4689:Naip2 UTSW 13 100148812 missense probably damaging 1.00
R4797:Naip2 UTSW 13 100161735 missense probably damaging 1.00
R4852:Naip2 UTSW 13 100161536 missense probably benign
R4922:Naip2 UTSW 13 100154960 missense probably benign
R5135:Naip2 UTSW 13 100179440 missense probably damaging 0.98
R5185:Naip2 UTSW 13 100189351 missense probably damaging 1.00
R5265:Naip2 UTSW 13 100152560 missense probably damaging 1.00
R5451:Naip2 UTSW 13 100188860 missense probably benign 0.12
R5521:Naip2 UTSW 13 100154914 missense probably damaging 1.00
R5737:Naip2 UTSW 13 100161854 missense probably benign 0.38
R6244:Naip2 UTSW 13 100152137 missense probably damaging 1.00
R6478:Naip2 UTSW 13 100162041 missense probably benign
R6480:Naip2 UTSW 13 100162041 missense probably benign
R6481:Naip2 UTSW 13 100162041 missense probably benign
R6490:Naip2 UTSW 13 100160685 missense probably benign
R6653:Naip2 UTSW 13 100152136 missense probably benign 0.00
R6653:Naip2 UTSW 13 100161844 missense probably benign
R6768:Naip2 UTSW 13 100178324 nonsense probably null
R6791:Naip2 UTSW 13 100154960 missense probably benign
R6793:Naip2 UTSW 13 100154960 missense probably benign
R6890:Naip2 UTSW 13 100162041 missense probably benign
R7036:Naip2 UTSW 13 100155021 missense probably benign 0.00
R7213:Naip2 UTSW 13 100187483 missense probably damaging 1.00
R7342:Naip2 UTSW 13 100189356 missense probably benign 0.09
R7445:Naip2 UTSW 13 100161782 missense probably benign 0.01
R7572:Naip2 UTSW 13 100154960 missense probably benign
R7699:Naip2 UTSW 13 100160369 missense probably benign 0.00
R7840:Naip2 UTSW 13 100144409 missense probably benign 0.14
R7874:Naip2 UTSW 13 100154951 missense probably benign 0.00
R7874:Naip2 UTSW 13 100154960 missense probably benign
R8038:Naip2 UTSW 13 100162062 missense probably benign 0.00
R8065:Naip2 UTSW 13 100189222 missense probably damaging 1.00
R8094:Naip2 UTSW 13 100161782 missense probably benign 0.01
R8166:Naip2 UTSW 13 100162007 missense probably benign 0.03
R8378:Naip2 UTSW 13 100161782 missense probably benign 0.01
R8669:Naip2 UTSW 13 100188969 missense probably benign 0.05
R8691:Naip2 UTSW 13 100161168 missense probably damaging 1.00
R8716:Naip2 UTSW 13 100144406 missense probably benign
R8720:Naip2 UTSW 13 100162122 missense probably benign 0.04
R8888:Naip2 UTSW 13 100189136 missense probably benign 0.01
R9031:Naip2 UTSW 13 100178268 missense possibly damaging 0.55
R9072:Naip2 UTSW 13 100154951 missense probably benign 0.00
R9072:Naip2 UTSW 13 100154960 missense probably benign
R9074:Naip2 UTSW 13 100154951 missense probably benign 0.00
R9074:Naip2 UTSW 13 100154960 missense probably benign
R9077:Naip2 UTSW 13 100154951 missense probably benign 0.00
R9077:Naip2 UTSW 13 100154960 missense probably benign
R9176:Naip2 UTSW 13 100162199 missense probably damaging 1.00
R9219:Naip2 UTSW 13 100160705 missense probably benign 0.06
R9358:Naip2 UTSW 13 100161572 missense probably damaging 1.00
R9371:Naip2 UTSW 13 100161846 nonsense probably null
R9414:Naip2 UTSW 13 100161735 missense probably damaging 1.00
R9415:Naip2 UTSW 13 100161735 missense probably damaging 1.00
R9416:Naip2 UTSW 13 100161735 missense probably damaging 1.00
V5622:Naip2 UTSW 13 100155021 missense probably benign 0.00
V5622:Naip2 UTSW 13 100155021 missense probably benign 0.00
V5622:Naip2 UTSW 13 100155029 intron probably benign
X0063:Naip2 UTSW 13 100161758 missense probably damaging 1.00
Y5405:Naip2 UTSW 13 100154960 missense probably benign
Z1088:Naip2 UTSW 13 100161909 missense probably benign
Z1176:Naip2 UTSW 13 100161593 missense probably benign 0.02
Z1176:Naip2 UTSW 13 100161909 missense probably benign
Z1177:Naip2 UTSW 13 100152629 missense possibly damaging 0.65
Z1177:Naip2 UTSW 13 100161909 missense probably benign
Z1177:Naip2 UTSW 13 100162865 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGGACTCCAGTCTTGCCTC -3'
(R):5'- GTGGATGCACTTTCAGTCTTGAAG -3'

Sequencing Primer
(F):5'- AGCATCTTCTCTGGACTCTTAAC -3'
(R):5'- CTTGAAGAGACAACAAGAAGAAGACC -3'
Posted On 2021-08-02