Incidental Mutation 'R8895:Dsg2'
ID 677992
Institutional Source Beutler Lab
Gene Symbol Dsg2
Ensembl Gene ENSMUSG00000044393
Gene Name desmoglein 2
Synonyms D18Ertd293e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock # R8895 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 20558074-20604521 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 20590069 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 384 (V384G)
Ref Sequence ENSEMBL: ENSMUSP00000057096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059787] [ENSMUST00000120102]
AlphaFold O55111
Predicted Effect probably damaging
Transcript: ENSMUST00000059787
AA Change: V384G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057096
Gene: ENSMUSG00000044393
AA Change: V384G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 75 162 2.39e-8 SMART
CA 186 275 5.17e-27 SMART
CA 298 392 1.94e-8 SMART
CA 418 502 2.34e-16 SMART
transmembrane domain 618 640 N/A INTRINSIC
low complexity region 822 838 N/A INTRINSIC
low complexity region 914 928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120102
SMART Domains Protein: ENSMUSP00000113153
Gene: ENSMUSG00000044393

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 75 162 2.39e-8 SMART
CA 186 275 5.17e-27 SMART
Pfam:Cadherin 282 347 6.9e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Mice lacking the encoded protein die in utero. Mutant mice lacking a part of the extracellular adhesive domain of the encoded protein develop cardiac fibrosis and dilation. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality before somite formation, impaired cell proliferation, and increased apoptosis. Heterozygous mutation of this gene also results in embryonic lethality before somite formation with partial penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik G A X: 70,394,388 R100W possibly damaging Het
4931409K22Rik T C 5: 24,550,630 D298G probably benign Het
5830411N06Rik C T 7: 140,261,619 P279S possibly damaging Het
Adamts10 G A 17: 33,549,296 R814H probably damaging Het
Akr1a1 A G 4: 116,641,063 L95P probably damaging Het
Amigo2 G T 15: 97,245,508 N344K probably damaging Het
Ankrd11 T C 8: 122,894,275 D946G possibly damaging Het
Btnl6 T G 17: 34,515,417 I124L probably benign Het
Bzw2 A T 12: 36,123,983 C97* probably null Het
Celsr2 G A 3: 108,413,564 T644I possibly damaging Het
Cep85l A T 10: 53,348,815 L226Q possibly damaging Het
Ces1g T C 8: 93,319,884 K338E possibly damaging Het
Cldn10 G A 14: 118,855,095 D36N probably damaging Het
Cntnap4 T A 8: 112,752,966 I261N probably benign Het
Csnk1g1 T C 9: 66,007,827 probably null Het
Cyp2c69 T C 19: 39,881,466 D104G possibly damaging Het
Cyp3a11 T C 5: 145,860,520 T350A probably benign Het
Daw1 T A 1: 83,209,290 C274S probably damaging Het
Dmtn T C 14: 70,612,704 T267A probably benign Het
Dock5 A G 14: 67,817,663 Y585H possibly damaging Het
Elmo1 C T 13: 20,564,460 L492F probably damaging Het
Fam172a T A 13: 77,999,654 N280K probably damaging Het
Fmo1 T C 1: 162,830,258 D438G probably benign Het
Folr2 C T 7: 101,840,201 V244M unknown Het
Galnt18 T C 7: 111,779,502 I16V possibly damaging Het
Gm10036 C A 18: 15,833,150 Y119* probably null Het
Gm853 T C 4: 130,211,430 K316E probably benign Het
Gm884 T A 11: 103,618,830 T771S unknown Het
Gria4 A G 9: 4,664,951 S102P probably damaging Het
Hc A T 2: 35,000,849 N1318K probably benign Het
Ifitm1 T C 7: 140,969,586 L94P probably damaging Het
Itga9 G A 9: 118,681,767 V455M probably damaging Het
Kank4 C T 4: 98,765,510 V894I possibly damaging Het
Kcnip2 T A 19: 45,796,661 probably benign Het
Lamb1 A G 12: 31,302,954 T885A possibly damaging Het
Lamp5 A G 2: 136,060,954 T198A probably benign Het
Lipi A T 16: 75,555,822 L376I probably benign Het
Luc7l T C 17: 26,254,004 I31T possibly damaging Het
Malrd1 A T 2: 15,845,227 N1219I unknown Het
Mcf2l C T 8: 12,984,330 probably benign Het
Mrc1 A C 2: 14,307,949 N894T probably damaging Het
Mrpl35 C T 6: 71,816,287 A127T possibly damaging Het
Myom2 T A 8: 15,102,589 Y645* probably null Het
Naip2 T C 13: 100,189,136 H88R probably benign Het
Noc3l T A 19: 38,810,307 K282N probably damaging Het
Nwd2 T C 5: 63,805,898 Y942H probably damaging Het
Olfr1123 T C 2: 87,418,315 V87A probably benign Het
Olfr646 T A 7: 104,107,095 I272N probably damaging Het
Osbpl9 C A 4: 109,073,136 A221S probably benign Het
Paip1 T C 13: 119,430,265 L45S probably benign Het
Peak1 T C 9: 56,206,654 T1668A probably benign Het
Pgap3 A G 11: 98,390,776 F199L possibly damaging Het
Ppip5k2 T C 1: 97,711,819 M1061V probably benign Het
Ppp6r3 A T 19: 3,494,017 W333R probably damaging Het
Ptk2b T A 14: 66,174,793 N383I probably benign Het
Rab21 G C 10: 115,315,175 R58G probably benign Het
Rabif C T 1: 134,506,197 T83I probably damaging Het
Rdh7 A T 10: 127,888,561 F18Y probably benign Het
Sept5 A G 16: 18,623,111 M315T possibly damaging Het
Slc27a6 A G 18: 58,582,234 Y303C probably damaging Het
Slc7a7 T A 14: 54,369,836 M495L probably benign Het
Sntg1 T A 1: 8,677,850 probably null Het
Spred2 T A 11: 20,001,019 I72N probably benign Het
St3gal1 A T 15: 67,108,237 I271N possibly damaging Het
Stox1 A T 10: 62,659,607 H962Q probably benign Het
Supt6 A T 11: 78,212,838 M1347K probably damaging Het
Susd2 G T 10: 75,639,618 A484D possibly damaging Het
Tmem260 A G 14: 48,500,388 probably benign Het
Tpbg C A 9: 85,844,467 A163E possibly damaging Het
Tpx2 T C 2: 152,882,335 Y344H probably damaging Het
Ttf2 A T 3: 100,962,712 F348L probably benign Het
Ttn A T 2: 76,833,306 V11675E unknown Het
Txnl4b T A 8: 109,572,835 Y142* probably null Het
Vmn2r18 G A 5: 151,561,675 R785C possibly damaging Het
Zbtb18 T A 1: 177,448,478 V459E probably damaging Het
Other mutations in Dsg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Dsg2 APN 18 20601769 missense probably benign 0.10
IGL00979:Dsg2 APN 18 20582767 missense probably damaging 0.99
IGL01081:Dsg2 APN 18 20589942 unclassified probably benign
IGL01358:Dsg2 APN 18 20601793 missense probably damaging 0.98
IGL02002:Dsg2 APN 18 20579176 missense probably damaging 1.00
IGL02263:Dsg2 APN 18 20590020 missense possibly damaging 0.70
IGL02410:Dsg2 APN 18 20602132 missense probably benign 0.04
IGL02553:Dsg2 APN 18 20592410 missense probably damaging 1.00
IGL03036:Dsg2 APN 18 20579077 missense probably damaging 0.99
dissolute UTSW 18 20595951 splice site probably null
Dysjunction UTSW 18 20582939 nonsense probably null
weg UTSW 18 20580651 nonsense probably null
R0094:Dsg2 UTSW 18 20591853 missense probably benign 0.08
R0094:Dsg2 UTSW 18 20591853 missense probably benign 0.08
R0105:Dsg2 UTSW 18 20602054 missense probably benign 0.03
R0105:Dsg2 UTSW 18 20602054 missense probably benign 0.03
R0112:Dsg2 UTSW 18 20583042 missense probably benign 0.02
R0305:Dsg2 UTSW 18 20582695 splice site probably benign
R0380:Dsg2 UTSW 18 20582939 nonsense probably null
R0401:Dsg2 UTSW 18 20592508 splice site probably benign
R0421:Dsg2 UTSW 18 20579391 missense probably damaging 1.00
R0578:Dsg2 UTSW 18 20594234 missense probably benign 0.00
R0667:Dsg2 UTSW 18 20573499 missense possibly damaging 0.50
R1223:Dsg2 UTSW 18 20573493 missense probably benign 0.23
R1433:Dsg2 UTSW 18 20582723 missense probably damaging 0.98
R1543:Dsg2 UTSW 18 20594211 missense probably benign 0.33
R1730:Dsg2 UTSW 18 20591880 missense probably benign 0.01
R1783:Dsg2 UTSW 18 20591880 missense probably benign 0.01
R1946:Dsg2 UTSW 18 20580548 missense probably damaging 1.00
R1991:Dsg2 UTSW 18 20601473 missense probably damaging 1.00
R1992:Dsg2 UTSW 18 20601473 missense probably damaging 1.00
R2027:Dsg2 UTSW 18 20583004 unclassified probably benign
R2109:Dsg2 UTSW 18 20592289 missense probably benign 0.00
R2143:Dsg2 UTSW 18 20579161 missense probably damaging 1.00
R2201:Dsg2 UTSW 18 20596054 missense probably damaging 1.00
R2343:Dsg2 UTSW 18 20602298 missense probably damaging 0.99
R2937:Dsg2 UTSW 18 20579128 missense probably damaging 1.00
R3710:Dsg2 UTSW 18 20602117 missense probably damaging 1.00
R3734:Dsg2 UTSW 18 20601947 missense probably benign 0.41
R3773:Dsg2 UTSW 18 20591862 missense probably damaging 1.00
R4176:Dsg2 UTSW 18 20580663 missense probably benign 0.25
R4213:Dsg2 UTSW 18 20598514 missense probably benign 0.01
R4299:Dsg2 UTSW 18 20595951 splice site probably null
R4515:Dsg2 UTSW 18 20601387 missense probably benign
R4649:Dsg2 UTSW 18 20602245 missense possibly damaging 0.56
R4940:Dsg2 UTSW 18 20579430 missense probably damaging 1.00
R4949:Dsg2 UTSW 18 20590184 missense probably damaging 1.00
R4998:Dsg2 UTSW 18 20601521 missense probably benign 0.26
R5078:Dsg2 UTSW 18 20596083 critical splice donor site probably null
R5155:Dsg2 UTSW 18 20598658 missense possibly damaging 0.67
R5398:Dsg2 UTSW 18 20579133 missense probably benign 0.45
R5503:Dsg2 UTSW 18 20580651 nonsense probably null
R6133:Dsg2 UTSW 18 20590089 missense probably benign 0.00
R6163:Dsg2 UTSW 18 20598669 critical splice donor site probably null
R6226:Dsg2 UTSW 18 20579449 missense probably damaging 0.98
R6228:Dsg2 UTSW 18 20594293 critical splice donor site probably null
R6241:Dsg2 UTSW 18 20590217 splice site probably null
R6482:Dsg2 UTSW 18 20601314 missense possibly damaging 0.69
R6524:Dsg2 UTSW 18 20583036 missense probably damaging 1.00
R6856:Dsg2 UTSW 18 20601802 missense probably damaging 0.98
R7058:Dsg2 UTSW 18 20592275 missense probably benign 0.00
R7108:Dsg2 UTSW 18 20601863 missense probably damaging 1.00
R7149:Dsg2 UTSW 18 20579454 missense probably damaging 0.98
R7207:Dsg2 UTSW 18 20601459 missense probably damaging 0.99
R7256:Dsg2 UTSW 18 20591931 missense possibly damaging 0.96
R7315:Dsg2 UTSW 18 20579160 missense probably damaging 0.97
R7471:Dsg2 UTSW 18 20580618 missense probably benign 0.08
R7558:Dsg2 UTSW 18 20594234 missense probably benign 0.00
R8094:Dsg2 UTSW 18 20583004 unclassified probably benign
R8118:Dsg2 UTSW 18 20582801 missense probably benign 0.11
R8157:Dsg2 UTSW 18 20580549 missense probably damaging 1.00
R8307:Dsg2 UTSW 18 20575064 missense probably benign 0.19
R8308:Dsg2 UTSW 18 20575064 missense probably benign 0.19
R8488:Dsg2 UTSW 18 20601374 missense probably damaging 1.00
R8520:Dsg2 UTSW 18 20579451 missense probably damaging 1.00
R8669:Dsg2 UTSW 18 20590075 missense probably damaging 1.00
R8675:Dsg2 UTSW 18 20601918 missense possibly damaging 0.75
R8750:Dsg2 UTSW 18 20575012 missense possibly damaging 0.90
R8773:Dsg2 UTSW 18 20582999 missense probably damaging 1.00
R8888:Dsg2 UTSW 18 20590069 missense probably damaging 1.00
R8912:Dsg2 UTSW 18 20582821 missense probably damaging 1.00
R8925:Dsg2 UTSW 18 20592478 missense probably damaging 1.00
R8927:Dsg2 UTSW 18 20592478 missense probably damaging 1.00
R9263:Dsg2 UTSW 18 20594166 missense probably benign 0.33
R9328:Dsg2 UTSW 18 20582790 missense possibly damaging 0.81
Z1176:Dsg2 UTSW 18 20580621 missense probably damaging 1.00
Z1177:Dsg2 UTSW 18 20602249 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTGCACATTTATCTGTGTGTCT -3'
(R):5'- TGCCCTCAGAGGCTAGAAAAGG -3'

Sequencing Primer
(F):5'- GTCTGTGTGTGTGCACTTCTATCTC -3'
(R):5'- TGATTGTGAGCCATGCAAGC -3'
Posted On 2021-08-02