Incidental Mutation 'R8895:4930567H17Rik'
ID 677997
Institutional Source Beutler Lab
Gene Symbol 4930567H17Rik
Ensembl Gene ENSMUSG00000073141
Gene Name RIKEN cDNA 4930567H17 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock # R8895 (G1)
Quality Score 221.999
Status Validated
Chromosome X
Chromosomal Location 70393901-70394740 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 70394388 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 100 (R100W)
Ref Sequence ENSEMBL: ENSMUSP00000090060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053981] [ENSMUST00000092405]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000053981
SMART Domains Protein: ENSMUSP00000052765
Gene: ENSMUSG00000045237

DomainStartEndE-ValueType
ASCH 6 114 3.72e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000092405
AA Change: R100W

PolyPhen 2 Score 0.710 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000090060
Gene: ENSMUSG00000073141
AA Change: R100W

DomainStartEndE-ValueType
SCOP:d1sig__ 115 223 1e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (74/74)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931409K22Rik T C 5: 24,550,630 D298G probably benign Het
5830411N06Rik C T 7: 140,261,619 P279S possibly damaging Het
Adamts10 G A 17: 33,549,296 R814H probably damaging Het
Akr1a1 A G 4: 116,641,063 L95P probably damaging Het
Amigo2 G T 15: 97,245,508 N344K probably damaging Het
Ankrd11 T C 8: 122,894,275 D946G possibly damaging Het
Btnl6 T G 17: 34,515,417 I124L probably benign Het
Bzw2 A T 12: 36,123,983 C97* probably null Het
Celsr2 G A 3: 108,413,564 T644I possibly damaging Het
Cep85l A T 10: 53,348,815 L226Q possibly damaging Het
Ces1g T C 8: 93,319,884 K338E possibly damaging Het
Cldn10 G A 14: 118,855,095 D36N probably damaging Het
Cntnap4 T A 8: 112,752,966 I261N probably benign Het
Csnk1g1 T C 9: 66,007,827 probably null Het
Cyp2c69 T C 19: 39,881,466 D104G possibly damaging Het
Cyp3a11 T C 5: 145,860,520 T350A probably benign Het
Daw1 T A 1: 83,209,290 C274S probably damaging Het
Dmtn T C 14: 70,612,704 T267A probably benign Het
Dock5 A G 14: 67,817,663 Y585H possibly damaging Het
Dsg2 T G 18: 20,590,069 V384G probably damaging Het
Elmo1 C T 13: 20,564,460 L492F probably damaging Het
Fam172a T A 13: 77,999,654 N280K probably damaging Het
Fmo1 T C 1: 162,830,258 D438G probably benign Het
Folr2 C T 7: 101,840,201 V244M unknown Het
Galnt18 T C 7: 111,779,502 I16V possibly damaging Het
Gm10036 C A 18: 15,833,150 Y119* probably null Het
Gm853 T C 4: 130,211,430 K316E probably benign Het
Gm884 T A 11: 103,618,830 T771S unknown Het
Gria4 A G 9: 4,664,951 S102P probably damaging Het
Hc A T 2: 35,000,849 N1318K probably benign Het
Ifitm1 T C 7: 140,969,586 L94P probably damaging Het
Itga9 G A 9: 118,681,767 V455M probably damaging Het
Kank4 C T 4: 98,765,510 V894I possibly damaging Het
Kcnip2 T A 19: 45,796,661 probably benign Het
Lamb1 A G 12: 31,302,954 T885A possibly damaging Het
Lamp5 A G 2: 136,060,954 T198A probably benign Het
Lipi A T 16: 75,555,822 L376I probably benign Het
Luc7l T C 17: 26,254,004 I31T possibly damaging Het
Malrd1 A T 2: 15,845,227 N1219I unknown Het
Mcf2l C T 8: 12,984,330 probably benign Het
Mrc1 A C 2: 14,307,949 N894T probably damaging Het
Mrpl35 C T 6: 71,816,287 A127T possibly damaging Het
Myom2 T A 8: 15,102,589 Y645* probably null Het
Naip2 T C 13: 100,189,136 H88R probably benign Het
Noc3l T A 19: 38,810,307 K282N probably damaging Het
Nwd2 T C 5: 63,805,898 Y942H probably damaging Het
Olfr1123 T C 2: 87,418,315 V87A probably benign Het
Olfr646 T A 7: 104,107,095 I272N probably damaging Het
Osbpl9 C A 4: 109,073,136 A221S probably benign Het
Paip1 T C 13: 119,430,265 L45S probably benign Het
Peak1 T C 9: 56,206,654 T1668A probably benign Het
Pgap3 A G 11: 98,390,776 F199L possibly damaging Het
Ppip5k2 T C 1: 97,711,819 M1061V probably benign Het
Ppp6r3 A T 19: 3,494,017 W333R probably damaging Het
Ptk2b T A 14: 66,174,793 N383I probably benign Het
Rab21 G C 10: 115,315,175 R58G probably benign Het
Rabif C T 1: 134,506,197 T83I probably damaging Het
Rdh7 A T 10: 127,888,561 F18Y probably benign Het
Sept5 A G 16: 18,623,111 M315T possibly damaging Het
Slc27a6 A G 18: 58,582,234 Y303C probably damaging Het
Slc7a7 T A 14: 54,369,836 M495L probably benign Het
Sntg1 T A 1: 8,677,850 probably null Het
Spred2 T A 11: 20,001,019 I72N probably benign Het
St3gal1 A T 15: 67,108,237 I271N possibly damaging Het
Stox1 A T 10: 62,659,607 H962Q probably benign Het
Supt6 A T 11: 78,212,838 M1347K probably damaging Het
Susd2 G T 10: 75,639,618 A484D possibly damaging Het
Tmem260 A G 14: 48,500,388 probably benign Het
Tpbg C A 9: 85,844,467 A163E possibly damaging Het
Tpx2 T C 2: 152,882,335 Y344H probably damaging Het
Ttf2 A T 3: 100,962,712 F348L probably benign Het
Ttn A T 2: 76,833,306 V11675E unknown Het
Txnl4b T A 8: 109,572,835 Y142* probably null Het
Vmn2r18 G A 5: 151,561,675 R785C possibly damaging Het
Zbtb18 T A 1: 177,448,478 V459E probably damaging Het
Other mutations in 4930567H17Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0737:4930567H17Rik UTSW X 70394207 unclassified probably benign
R2257:4930567H17Rik UTSW X 70394406 missense probably damaging 1.00
R3919:4930567H17Rik UTSW X 70394529 missense probably benign 0.07
R3939:4930567H17Rik UTSW X 70394529 missense probably benign 0.07
R3940:4930567H17Rik UTSW X 70394529 missense probably benign 0.07
R4231:4930567H17Rik UTSW X 70394529 missense probably benign 0.07
R4232:4930567H17Rik UTSW X 70394529 missense probably benign 0.07
R4234:4930567H17Rik UTSW X 70394529 missense probably benign 0.07
R4235:4930567H17Rik UTSW X 70394529 missense probably benign 0.07
R4236:4930567H17Rik UTSW X 70394529 missense probably benign 0.07
R8139:4930567H17Rik UTSW X 70394514 missense possibly damaging 0.89
R8890:4930567H17Rik UTSW X 70394388 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- ACAGTTGTTTTCCGTGTAATGATCA -3'
(R):5'- ATGGAAGACGGCATCACACC -3'

Sequencing Primer
(F):5'- CCGTGTAATGATCATCATCGTC -3'
(R):5'- GGGCCTCTGAGACCACATAAAAG -3'
Posted On 2021-08-02