Incidental Mutation 'R8896:Aox4'
ID 677998
Institutional Source Beutler Lab
Gene Symbol Aox4
Ensembl Gene ENSMUSG00000038242
Gene Name aldehyde oxidase 4
Synonyms 2310003G12Rik, AOH2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8896 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 58210397-58268597 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 58252074 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 784 (S784A)
Ref Sequence ENSEMBL: ENSMUSP00000048929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040442]
AlphaFold Q3TYQ9
Predicted Effect probably benign
Transcript: ENSMUST00000040442
AA Change: S784A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048929
Gene: ENSMUSG00000038242
AA Change: S784A

DomainStartEndE-ValueType
Pfam:Fer2 12 82 1.6e-10 PFAM
Pfam:Fer2_2 91 165 4.6e-30 PFAM
Pfam:FAD_binding_5 240 421 2.7e-47 PFAM
CO_deh_flav_C 428 532 1.19e-26 SMART
Ald_Xan_dh_C 596 699 8.22e-39 SMART
Pfam:Ald_Xan_dh_C2 709 1243 1.1e-178 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (73/73)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit a slight decrease in prenatal survival and epidermal thickening that is exacerbated by UV treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3d1 T A 10: 80,716,591 H581L probably benign Het
Atp11a T C 8: 12,849,781 Y915H probably damaging Het
Atp4b T C 8: 13,387,514 D213G probably benign Het
Bcl11a A G 11: 24,163,640 S328G probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
Cadps2 T A 6: 23,410,877 Y685F probably damaging Het
Ccdc88b C T 19: 6,853,835 A580T probably benign Het
Cdc42bpa GACAACA GACA 1: 180,130,808 probably benign Het
Cep152 A T 2: 125,566,235 V1396D possibly damaging Het
Ces1c T C 8: 93,106,626 I404V probably benign Het
Cr2 A T 1: 195,169,273 M137K possibly damaging Het
Cyp2d40 T C 15: 82,760,253 Y257C unknown Het
Dennd1c T A 17: 57,074,512 D116V probably damaging Het
Dph2 G A 4: 117,890,378 R270* probably null Het
Dpp8 A C 9: 65,078,036 H792P possibly damaging Het
Dupd1 T C 14: 21,686,695 D113G probably benign Het
Efs T C 14: 54,920,299 E185G possibly damaging Het
Eml3 A G 19: 8,936,692 E480G probably damaging Het
Fam193a A G 5: 34,426,484 T336A probably benign Het
Fermt1 C T 2: 132,941,932 probably benign Het
Galnt4 T A 10: 99,110,093 V560D probably damaging Het
Gbp2b C A 3: 142,603,566 T146K probably damaging Het
Gbp5 C T 3: 142,505,547 T346I probably damaging Het
Glrx G T 13: 75,847,198 C79F probably damaging Het
Glt8d2 T A 10: 82,654,782 T225S probably damaging Het
Grm3 A G 5: 9,512,483 F456L possibly damaging Het
Gse1 T G 8: 120,576,446 S1109A unknown Het
Gstp3 A T 19: 4,058,573 L63Q probably damaging Het
Hapln3 G A 7: 79,117,491 R267W probably benign Het
Herc4 T A 10: 63,311,507 I801N possibly damaging Het
Ido1 G T 8: 24,587,864 D153E probably benign Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcnj9 T A 1: 172,325,793 S255C probably damaging Het
Kpna3 T C 14: 61,391,845 N39D probably benign Het
Krt39 A T 11: 99,518,269 S269T probably damaging Het
Lfng G A 5: 140,613,223 V296I probably benign Het
Lrit3 T A 3: 129,791,483 I209F probably damaging Het
Map4k5 T A 12: 69,823,501 D523V possibly damaging Het
Mdn1 C T 4: 32,678,328 P652L probably benign Het
Med30 G A 15: 52,721,120 V145I possibly damaging Het
Megf6 T A 4: 154,242,403 D163E probably damaging Het
Meltf T A 16: 31,890,704 probably benign Het
Mindy4 T C 6: 55,278,238 L567P probably benign Het
Mppe1 T C 18: 67,237,401 D75G probably damaging Het
Muc4 C T 16: 32,754,673 P1516S probably benign Het
Myo3b C A 2: 70,238,816 F494L probably damaging Het
Nedd4l A G 18: 65,165,617 T226A probably benign Het
Nod1 A G 6: 54,944,292 V347A probably benign Het
Nup210 A T 6: 91,042,253 probably null Het
Nup210l A G 3: 90,118,625 R185G probably damaging Het
Olfr202 A T 16: 59,284,089 M136K probably damaging Het
Olfr62 A T 4: 118,666,305 M263L probably benign Het
Olfr957 A G 9: 39,511,474 L82P probably damaging Het
Oma1 T C 4: 103,353,632 L445S probably damaging Het
Oxsm A T 14: 16,242,677 F31I probably benign Het
Pdcd5 A T 7: 35,647,370 M1K probably null Het
Pkd1l2 T C 8: 117,013,876 T2161A possibly damaging Het
Pla2g3 A T 11: 3,492,151 S404C probably null Het
Plec A G 15: 76,194,360 V60A unknown Het
Prpsap2 A G 11: 61,752,910 S66P possibly damaging Het
Rarb A G 14: 16,436,804 L239P probably damaging Het
Ryr3 A T 2: 112,753,050 Y2845* probably null Het
Spta1 T C 1: 174,217,982 C1569R probably damaging Het
Stard13 G A 5: 151,062,650 S465L probably damaging Het
Tmub1 A T 5: 24,446,682 S80T probably benign Het
Trpv5 A G 6: 41,670,913 F322S probably damaging Het
Vmn2r5 G A 3: 64,503,782 A455V probably benign Het
Washc4 T A 10: 83,570,018 N459K probably damaging Het
Wdr11 C T 7: 129,605,713 R300* probably null Het
Zer1 A G 2: 30,103,418 F559L probably damaging Het
Zfat A T 15: 68,180,670 V425D probably damaging Het
Zfp738 G A 13: 67,669,791 L694F Het
Zfp839 C T 12: 110,868,843 A844V probably damaging Het
Other mutations in Aox4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Aox4 APN 1 58239174 missense probably damaging 1.00
IGL01011:Aox4 APN 1 58240775 nonsense probably null
IGL01634:Aox4 APN 1 58221930 missense possibly damaging 0.81
IGL01689:Aox4 APN 1 58245161 splice site probably benign
IGL01874:Aox4 APN 1 58252084 missense probably damaging 1.00
IGL02104:Aox4 APN 1 58236657 splice site probably benign
IGL02744:Aox4 APN 1 58255552 missense possibly damaging 0.90
IGL02751:Aox4 APN 1 58259052 missense probably damaging 1.00
IGL03225:Aox4 APN 1 58247227 missense possibly damaging 0.94
IGL03247:Aox4 APN 1 58264367 missense probably damaging 1.00
IGL03369:Aox4 APN 1 58262587 missense probably benign 0.01
BB008:Aox4 UTSW 1 58255486 missense probably benign 0.07
BB018:Aox4 UTSW 1 58255486 missense probably benign 0.07
R0138:Aox4 UTSW 1 58228866 missense probably damaging 1.00
R0243:Aox4 UTSW 1 58213076 missense probably benign
R0368:Aox4 UTSW 1 58213079 missense probably benign 0.07
R0499:Aox4 UTSW 1 58263397 critical splice donor site probably null
R0513:Aox4 UTSW 1 58217519 missense probably benign
R0513:Aox4 UTSW 1 58247300 missense probably damaging 1.00
R0546:Aox4 UTSW 1 58250174 missense probably damaging 1.00
R0591:Aox4 UTSW 1 58239102 splice site probably benign
R0825:Aox4 UTSW 1 58248909 missense possibly damaging 0.55
R1912:Aox4 UTSW 1 58264402 missense probably damaging 1.00
R1934:Aox4 UTSW 1 58245936 missense probably benign 0.01
R2180:Aox4 UTSW 1 58213067 missense probably benign 0.00
R2293:Aox4 UTSW 1 58221937 missense probably damaging 0.99
R3017:Aox4 UTSW 1 58235204 missense probably benign
R3744:Aox4 UTSW 1 58245870 missense probably damaging 1.00
R3745:Aox4 UTSW 1 58245870 missense probably damaging 1.00
R3830:Aox4 UTSW 1 58255511 missense probably damaging 0.99
R3856:Aox4 UTSW 1 58253934 missense probably damaging 1.00
R4214:Aox4 UTSW 1 58221892 missense probably damaging 0.99
R4484:Aox4 UTSW 1 58262571 missense probably damaging 1.00
R4706:Aox4 UTSW 1 58266787 missense probably damaging 1.00
R4710:Aox4 UTSW 1 58255638 missense probably damaging 1.00
R4729:Aox4 UTSW 1 58259077 nonsense probably null
R4769:Aox4 UTSW 1 58259148 missense probably null 1.00
R4809:Aox4 UTSW 1 58266649 missense probably damaging 1.00
R4989:Aox4 UTSW 1 58236676 missense probably benign 0.00
R5082:Aox4 UTSW 1 58231483 missense possibly damaging 0.63
R5102:Aox4 UTSW 1 58240778 missense probably damaging 1.00
R5114:Aox4 UTSW 1 58246286 missense possibly damaging 0.89
R5133:Aox4 UTSW 1 58236676 missense probably benign 0.00
R5134:Aox4 UTSW 1 58236676 missense probably benign 0.00
R5185:Aox4 UTSW 1 58254318 missense probably damaging 1.00
R5217:Aox4 UTSW 1 58246241 nonsense probably null
R5426:Aox4 UTSW 1 58220094 missense probably damaging 1.00
R5443:Aox4 UTSW 1 58233992 splice site probably null
R5708:Aox4 UTSW 1 58245873 missense possibly damaging 0.69
R6052:Aox4 UTSW 1 58254318 nonsense probably null
R6167:Aox4 UTSW 1 58263935 missense probably damaging 1.00
R6179:Aox4 UTSW 1 58231503 missense probably benign
R6196:Aox4 UTSW 1 58217526 missense probably damaging 1.00
R6513:Aox4 UTSW 1 58213053 missense probably benign 0.01
R6781:Aox4 UTSW 1 58245109 missense probably benign 0.03
R6885:Aox4 UTSW 1 58264378 missense probably damaging 1.00
R7082:Aox4 UTSW 1 58224193 missense possibly damaging 0.82
R7127:Aox4 UTSW 1 58228874 missense probably benign 0.00
R7153:Aox4 UTSW 1 58250219 missense probably damaging 0.99
R7371:Aox4 UTSW 1 58263854 missense probably damaging 1.00
R7690:Aox4 UTSW 1 58263917 missense probably damaging 1.00
R7745:Aox4 UTSW 1 58240707 missense probably benign 0.01
R7752:Aox4 UTSW 1 58253948 missense not run
R7767:Aox4 UTSW 1 58235207 missense probably damaging 0.98
R7782:Aox4 UTSW 1 58231092 splice site probably null
R7931:Aox4 UTSW 1 58255486 missense probably benign 0.07
R7978:Aox4 UTSW 1 58235207 missense probably damaging 0.98
R7982:Aox4 UTSW 1 58257241 missense possibly damaging 0.81
R8316:Aox4 UTSW 1 58254311 missense possibly damaging 0.69
R8361:Aox4 UTSW 1 58240839 missense probably benign 0.03
R8829:Aox4 UTSW 1 58255490 missense probably benign 0.01
R8832:Aox4 UTSW 1 58255490 missense probably benign 0.01
R9103:Aox4 UTSW 1 58257282 missense probably damaging 1.00
R9241:Aox4 UTSW 1 58252186 missense probably damaging 1.00
R9282:Aox4 UTSW 1 58245869 missense possibly damaging 0.59
X0021:Aox4 UTSW 1 58247295 nonsense probably null
X0028:Aox4 UTSW 1 58254183 missense probably damaging 0.99
Z1176:Aox4 UTSW 1 58246351 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- GATCCCAGCTGCAGTCTAATG -3'
(R):5'- TGGAAGGACTCACACAACTC -3'

Sequencing Primer
(F):5'- TCCCAGCTGCAGTCTAATGAGAAG -3'
(R):5'- GGACTCACACAACTCAGACTACTG -3'
Posted On 2021-08-02