Incidental Mutation 'R8896:Myo3b'
ID 678004
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Name myosin IIIB
Synonyms A430065P19Rik
MMRRC Submission 068698-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8896 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 69869470-70259542 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 70069160 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 494 (F494L)
Ref Sequence ENSEMBL: ENSMUSP00000055362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112243]
AlphaFold Q1EG27
Predicted Effect probably damaging
Transcript: ENSMUST00000060208
AA Change: F494L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: F494L

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112243
AA Change: F466L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: F466L

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox4 T G 1: 58,291,233 (GRCm39) S784A probably benign Het
Ap3d1 T A 10: 80,552,425 (GRCm39) H581L probably benign Het
Atp11a T C 8: 12,899,781 (GRCm39) Y915H probably damaging Het
Atp4b T C 8: 13,437,514 (GRCm39) D213G probably benign Het
Bcl11a A G 11: 24,113,640 (GRCm39) S328G probably benign Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Cadps2 T A 6: 23,410,876 (GRCm39) Y685F probably damaging Het
Ccdc88b C T 19: 6,831,203 (GRCm39) A580T probably benign Het
Cdc42bpa GACAACA GACA 1: 179,958,373 (GRCm39) probably benign Het
Cep152 A T 2: 125,408,155 (GRCm39) V1396D possibly damaging Het
Ces1c T C 8: 93,833,254 (GRCm39) I404V probably benign Het
Cr2 A T 1: 194,851,581 (GRCm39) M137K possibly damaging Het
Cyp2d40 T C 15: 82,644,454 (GRCm39) Y257C unknown Het
Dennd1c T A 17: 57,381,512 (GRCm39) D116V probably damaging Het
Dph2 G A 4: 117,747,575 (GRCm39) R270* probably null Het
Dpp8 A C 9: 64,985,318 (GRCm39) H792P possibly damaging Het
Dusp29 T C 14: 21,736,763 (GRCm39) D113G probably benign Het
Efs T C 14: 55,157,756 (GRCm39) E185G possibly damaging Het
Eml3 A G 19: 8,914,056 (GRCm39) E480G probably damaging Het
Fam193a A G 5: 34,583,828 (GRCm39) T336A probably benign Het
Fermt1 C T 2: 132,783,852 (GRCm39) probably benign Het
Galnt4 T A 10: 98,945,955 (GRCm39) V560D probably damaging Het
Gbp2b C A 3: 142,309,327 (GRCm39) T146K probably damaging Het
Gbp5 C T 3: 142,211,308 (GRCm39) T346I probably damaging Het
Glrx G T 13: 75,995,317 (GRCm39) C79F probably damaging Het
Glt8d2 T A 10: 82,490,616 (GRCm39) T225S probably damaging Het
Grm3 A G 5: 9,562,483 (GRCm39) F456L possibly damaging Het
Gse1 T G 8: 121,303,185 (GRCm39) S1109A unknown Het
Gstp3 A T 19: 4,108,573 (GRCm39) L63Q probably damaging Het
Hapln3 G A 7: 78,767,239 (GRCm39) R267W probably benign Het
Herc4 T A 10: 63,147,286 (GRCm39) I801N possibly damaging Het
Ido1 G T 8: 25,077,880 (GRCm39) D153E probably benign Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Kcnj9 T A 1: 172,153,360 (GRCm39) S255C probably damaging Het
Kpna3 T C 14: 61,629,294 (GRCm39) N39D probably benign Het
Krt39 A T 11: 99,409,095 (GRCm39) S269T probably damaging Het
Lfng G A 5: 140,598,978 (GRCm39) V296I probably benign Het
Lrit3 T A 3: 129,585,132 (GRCm39) I209F probably damaging Het
Map4k5 T A 12: 69,870,275 (GRCm39) D523V possibly damaging Het
Mdn1 C T 4: 32,678,328 (GRCm39) P652L probably benign Het
Med30 G A 15: 52,584,516 (GRCm39) V145I possibly damaging Het
Megf6 T A 4: 154,326,860 (GRCm39) D163E probably damaging Het
Meltf T A 16: 31,709,522 (GRCm39) probably benign Het
Mindy4 T C 6: 55,255,223 (GRCm39) L567P probably benign Het
Mppe1 T C 18: 67,370,472 (GRCm39) D75G probably damaging Het
Muc4 C T 16: 32,754,673 (GRCm38) P1516S probably benign Het
Nedd4l A G 18: 65,298,688 (GRCm39) T226A probably benign Het
Nod1 A G 6: 54,921,277 (GRCm39) V347A probably benign Het
Nup210 A T 6: 91,019,235 (GRCm39) probably null Het
Nup210l A G 3: 90,025,932 (GRCm39) R185G probably damaging Het
Oma1 T C 4: 103,210,829 (GRCm39) L445S probably damaging Het
Or13p10 A T 4: 118,523,502 (GRCm39) M263L probably benign Het
Or5ac20 A T 16: 59,104,452 (GRCm39) M136K probably damaging Het
Or8g36 A G 9: 39,422,770 (GRCm39) L82P probably damaging Het
Oxsm A T 14: 16,242,677 (GRCm38) F31I probably benign Het
Pdcd5 A T 7: 35,346,795 (GRCm39) M1K probably null Het
Pkd1l2 T C 8: 117,740,615 (GRCm39) T2161A possibly damaging Het
Pla2g3 A T 11: 3,442,151 (GRCm39) S404C probably null Het
Plec A G 15: 76,078,560 (GRCm39) V60A unknown Het
Prpsap2 A G 11: 61,643,736 (GRCm39) S66P possibly damaging Het
Rarb A G 14: 16,436,804 (GRCm38) L239P probably damaging Het
Ryr3 A T 2: 112,583,395 (GRCm39) Y2845* probably null Het
Spta1 T C 1: 174,045,548 (GRCm39) C1569R probably damaging Het
Stard13 G A 5: 150,986,115 (GRCm39) S465L probably damaging Het
Tmub1 A T 5: 24,651,680 (GRCm39) S80T probably benign Het
Trpv5 A G 6: 41,647,847 (GRCm39) F322S probably damaging Het
Vmn2r5 G A 3: 64,411,203 (GRCm39) A455V probably benign Het
Washc4 T A 10: 83,405,882 (GRCm39) N459K probably damaging Het
Wdr11 C T 7: 129,207,437 (GRCm39) R300* probably null Het
Zer1 A G 2: 29,993,430 (GRCm39) F559L probably damaging Het
Zfat A T 15: 68,052,519 (GRCm39) V425D probably damaging Het
Zfp738 G A 13: 67,817,910 (GRCm39) L694F Het
Zfp839 C T 12: 110,835,277 (GRCm39) A844V probably damaging Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 69,935,989 (GRCm39) splice site probably benign
IGL00959:Myo3b APN 2 70,144,636 (GRCm39) missense probably damaging 1.00
IGL01069:Myo3b APN 2 70,075,735 (GRCm39) missense probably benign 0.22
IGL01116:Myo3b APN 2 70,119,730 (GRCm39) missense probably damaging 1.00
IGL02097:Myo3b APN 2 70,069,173 (GRCm39) missense probably damaging 1.00
IGL02220:Myo3b APN 2 70,119,923 (GRCm39) splice site probably benign
IGL02553:Myo3b APN 2 69,925,568 (GRCm39) missense probably benign 0.00
IGL02557:Myo3b APN 2 70,085,663 (GRCm39) missense probably benign 0.16
IGL02648:Myo3b APN 2 69,935,716 (GRCm39) splice site probably benign
IGL02902:Myo3b APN 2 70,119,745 (GRCm39) missense probably benign 0.36
IGL02981:Myo3b APN 2 69,938,969 (GRCm39) missense probably damaging 1.00
IGL03030:Myo3b APN 2 70,257,160 (GRCm39) splice site probably benign
IGL03031:Myo3b APN 2 70,085,721 (GRCm39) missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70,257,160 (GRCm39) splice site probably benign
IGL03078:Myo3b APN 2 70,117,335 (GRCm39) missense probably damaging 1.00
IGL03224:Myo3b APN 2 70,180,283 (GRCm39) missense probably benign
IGL03329:Myo3b APN 2 70,084,803 (GRCm39) missense probably damaging 1.00
R0079:Myo3b UTSW 2 69,925,502 (GRCm39) missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70,047,510 (GRCm39) missense probably benign 0.00
R0238:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0238:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0239:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0239:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0313:Myo3b UTSW 2 70,179,303 (GRCm39) nonsense probably null
R0331:Myo3b UTSW 2 69,925,605 (GRCm39) missense probably damaging 1.00
R0371:Myo3b UTSW 2 70,083,304 (GRCm39) splice site probably benign
R0442:Myo3b UTSW 2 70,069,305 (GRCm39) critical splice donor site probably null
R0964:Myo3b UTSW 2 70,257,193 (GRCm39) missense probably damaging 1.00
R1217:Myo3b UTSW 2 70,161,224 (GRCm39) missense probably benign 0.02
R1429:Myo3b UTSW 2 70,083,351 (GRCm39) missense probably damaging 0.97
R1460:Myo3b UTSW 2 70,062,798 (GRCm39) missense probably benign 0.31
R1617:Myo3b UTSW 2 70,111,562 (GRCm39) missense probably benign 0.00
R1628:Myo3b UTSW 2 70,117,306 (GRCm39) missense probably benign 0.01
R1708:Myo3b UTSW 2 70,075,729 (GRCm39) nonsense probably null
R1940:Myo3b UTSW 2 70,088,419 (GRCm39) missense probably benign 0.01
R2407:Myo3b UTSW 2 70,085,597 (GRCm39) missense probably damaging 1.00
R3081:Myo3b UTSW 2 70,086,927 (GRCm39) splice site probably benign
R3687:Myo3b UTSW 2 70,075,658 (GRCm39) missense probably benign
R3745:Myo3b UTSW 2 70,064,829 (GRCm39) splice site probably benign
R4011:Myo3b UTSW 2 69,926,720 (GRCm39) missense probably benign 0.15
R4074:Myo3b UTSW 2 70,119,808 (GRCm39) missense probably damaging 1.00
R4419:Myo3b UTSW 2 69,926,706 (GRCm39) missense probably damaging 1.00
R4496:Myo3b UTSW 2 70,084,748 (GRCm39) missense probably benign
R4539:Myo3b UTSW 2 69,869,491 (GRCm39) start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70,069,186 (GRCm39) missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R4807:Myo3b UTSW 2 69,936,056 (GRCm39) missense probably damaging 1.00
R4849:Myo3b UTSW 2 70,075,253 (GRCm39) missense probably damaging 0.98
R4997:Myo3b UTSW 2 70,088,427 (GRCm39) missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70,088,412 (GRCm39) missense probably damaging 0.99
R5070:Myo3b UTSW 2 70,083,456 (GRCm39) missense probably damaging 1.00
R5072:Myo3b UTSW 2 69,925,593 (GRCm39) missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70,088,374 (GRCm39) missense probably benign 0.01
R5103:Myo3b UTSW 2 69,926,747 (GRCm39) missense probably benign 0.08
R5109:Myo3b UTSW 2 69,925,637 (GRCm39) missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70,257,232 (GRCm39) missense probably damaging 0.97
R5396:Myo3b UTSW 2 69,957,329 (GRCm39) missense probably damaging 0.99
R5400:Myo3b UTSW 2 69,935,724 (GRCm39) missense probably damaging 1.00
R5468:Myo3b UTSW 2 70,064,785 (GRCm39) missense probably benign 0.00
R5620:Myo3b UTSW 2 70,069,254 (GRCm39) missense probably benign 0.04
R5646:Myo3b UTSW 2 70,144,774 (GRCm39) missense probably damaging 0.97
R5729:Myo3b UTSW 2 69,936,083 (GRCm39) missense probably damaging 1.00
R5943:Myo3b UTSW 2 70,117,285 (GRCm39) missense probably benign 0.03
R5971:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70,069,113 (GRCm39) missense probably benign 0.00
R6138:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70,075,754 (GRCm39) critical splice donor site probably null
R6177:Myo3b UTSW 2 70,143,707 (GRCm39) missense probably benign 0.00
R6421:Myo3b UTSW 2 70,143,700 (GRCm39) missense probably benign 0.02
R6478:Myo3b UTSW 2 70,179,304 (GRCm39) missense probably benign
R6606:Myo3b UTSW 2 70,062,829 (GRCm39) missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70,119,856 (GRCm39) missense probably damaging 1.00
R6982:Myo3b UTSW 2 70,256,409 (GRCm39) missense probably benign 0.02
R6997:Myo3b UTSW 2 69,957,329 (GRCm39) missense probably damaging 0.99
R7032:Myo3b UTSW 2 69,925,608 (GRCm39) missense probably damaging 0.98
R7038:Myo3b UTSW 2 69,925,552 (GRCm39) missense probably benign 0.00
R7062:Myo3b UTSW 2 70,047,501 (GRCm39) missense probably benign 0.00
R7537:Myo3b UTSW 2 70,047,513 (GRCm39) missense probably benign 0.01
R7861:Myo3b UTSW 2 69,939,032 (GRCm39) missense probably damaging 1.00
R7955:Myo3b UTSW 2 69,925,623 (GRCm39) missense probably benign 0.37
R7977:Myo3b UTSW 2 70,161,277 (GRCm39) missense probably benign
R7978:Myo3b UTSW 2 70,083,458 (GRCm39) missense probably damaging 1.00
R7987:Myo3b UTSW 2 70,161,277 (GRCm39) missense probably benign
R8803:Myo3b UTSW 2 70,083,338 (GRCm39) missense probably benign
R8843:Myo3b UTSW 2 70,088,325 (GRCm39) missense probably damaging 1.00
R8904:Myo3b UTSW 2 70,257,252 (GRCm39) missense probably benign 0.07
R8909:Myo3b UTSW 2 70,083,440 (GRCm39) missense probably damaging 1.00
R9031:Myo3b UTSW 2 70,082,094 (GRCm39) missense probably damaging 0.99
R9052:Myo3b UTSW 2 70,062,747 (GRCm39) missense probably benign 0.00
R9251:Myo3b UTSW 2 70,088,425 (GRCm39) nonsense probably null
R9268:Myo3b UTSW 2 70,257,305 (GRCm39) makesense probably null
R9334:Myo3b UTSW 2 70,047,360 (GRCm39) missense probably damaging 1.00
R9377:Myo3b UTSW 2 70,069,242 (GRCm39) missense possibly damaging 0.78
R9457:Myo3b UTSW 2 69,925,553 (GRCm39) missense probably benign 0.01
R9520:Myo3b UTSW 2 70,062,753 (GRCm39) missense possibly damaging 0.67
R9593:Myo3b UTSW 2 70,075,648 (GRCm39) missense probably benign 0.43
R9671:Myo3b UTSW 2 70,086,908 (GRCm39) missense probably damaging 1.00
R9790:Myo3b UTSW 2 70,180,287 (GRCm39) missense probably benign 0.35
R9791:Myo3b UTSW 2 70,180,287 (GRCm39) missense probably benign 0.35
U15987:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70,062,747 (GRCm39) missense probably benign 0.00
X0065:Myo3b UTSW 2 70,088,313 (GRCm39) missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70,088,371 (GRCm39) missense probably benign 0.01
Z1177:Myo3b UTSW 2 69,926,705 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGGTTTGATGCTAACTTTCCC -3'
(R):5'- CTTCAAGATTGCCAGATTCTCC -3'

Sequencing Primer
(F):5'- ACTTTCCCAAGGTAGAGTTGC -3'
(R):5'- CTCCAGTTGGTGTGAACA -3'
Posted On 2021-08-02