Incidental Mutation 'R8896:Gbp2b'
ID 678011
Institutional Source Beutler Lab
Gene Symbol Gbp2b
Ensembl Gene ENSMUSG00000040264
Gene Name guanylate binding protein 2b
Synonyms Gbp1, Mpa1, Mag-1, Gbp-1, Mpa-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8896 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 142594847-142619179 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 142603566 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 146 (T146K)
Ref Sequence ENSEMBL: ENSMUSP00000029936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029936]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000029936
AA Change: T146K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029936
Gene: ENSMUSG00000040264
AA Change: T146K

DomainStartEndE-ValueType
Pfam:GBP 18 280 4.1e-122 PFAM
Pfam:GBP_C 282 578 5.5e-125 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanylate-binding protein (GBP) family. GBPs specifically bind guanine nucleotides (GMP, GDP, and GTP) and contain two of the three consensus motifs found in typical GTP-binding proteins. The encoded protein interacts with a member of the germinal center kinase family. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit increased susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox4 T G 1: 58,252,074 S784A probably benign Het
Ap3d1 T A 10: 80,716,591 H581L probably benign Het
Atp11a T C 8: 12,849,781 Y915H probably damaging Het
Atp4b T C 8: 13,387,514 D213G probably benign Het
Bcl11a A G 11: 24,163,640 S328G probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
Cadps2 T A 6: 23,410,877 Y685F probably damaging Het
Ccdc88b C T 19: 6,853,835 A580T probably benign Het
Cdc42bpa GACAACA GACA 1: 180,130,808 probably benign Het
Cep152 A T 2: 125,566,235 V1396D possibly damaging Het
Ces1c T C 8: 93,106,626 I404V probably benign Het
Cr2 A T 1: 195,169,273 M137K possibly damaging Het
Cyp2d40 T C 15: 82,760,253 Y257C unknown Het
Dennd1c T A 17: 57,074,512 D116V probably damaging Het
Dph2 G A 4: 117,890,378 R270* probably null Het
Dpp8 A C 9: 65,078,036 H792P possibly damaging Het
Dupd1 T C 14: 21,686,695 D113G probably benign Het
Efs T C 14: 54,920,299 E185G possibly damaging Het
Eml3 A G 19: 8,936,692 E480G probably damaging Het
Fam193a A G 5: 34,426,484 T336A probably benign Het
Fermt1 C T 2: 132,941,932 probably benign Het
Galnt4 T A 10: 99,110,093 V560D probably damaging Het
Gbp5 C T 3: 142,505,547 T346I probably damaging Het
Glrx G T 13: 75,847,198 C79F probably damaging Het
Glt8d2 T A 10: 82,654,782 T225S probably damaging Het
Grm3 A G 5: 9,512,483 F456L possibly damaging Het
Gse1 T G 8: 120,576,446 S1109A unknown Het
Gstp3 A T 19: 4,058,573 L63Q probably damaging Het
Hapln3 G A 7: 79,117,491 R267W probably benign Het
Herc4 T A 10: 63,311,507 I801N possibly damaging Het
Ido1 G T 8: 24,587,864 D153E probably benign Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcnj9 T A 1: 172,325,793 S255C probably damaging Het
Kpna3 T C 14: 61,391,845 N39D probably benign Het
Krt39 A T 11: 99,518,269 S269T probably damaging Het
Lfng G A 5: 140,613,223 V296I probably benign Het
Lrit3 T A 3: 129,791,483 I209F probably damaging Het
Map4k5 T A 12: 69,823,501 D523V possibly damaging Het
Mdn1 C T 4: 32,678,328 P652L probably benign Het
Med30 G A 15: 52,721,120 V145I possibly damaging Het
Megf6 T A 4: 154,242,403 D163E probably damaging Het
Meltf T A 16: 31,890,704 probably benign Het
Mindy4 T C 6: 55,278,238 L567P probably benign Het
Mppe1 T C 18: 67,237,401 D75G probably damaging Het
Muc4 C T 16: 32,754,673 P1516S probably benign Het
Myo3b C A 2: 70,238,816 F494L probably damaging Het
Nedd4l A G 18: 65,165,617 T226A probably benign Het
Nod1 A G 6: 54,944,292 V347A probably benign Het
Nup210 A T 6: 91,042,253 probably null Het
Nup210l A G 3: 90,118,625 R185G probably damaging Het
Olfr202 A T 16: 59,284,089 M136K probably damaging Het
Olfr62 A T 4: 118,666,305 M263L probably benign Het
Olfr957 A G 9: 39,511,474 L82P probably damaging Het
Oma1 T C 4: 103,353,632 L445S probably damaging Het
Oxsm A T 14: 16,242,677 F31I probably benign Het
Pdcd5 A T 7: 35,647,370 M1K probably null Het
Pkd1l2 T C 8: 117,013,876 T2161A possibly damaging Het
Pla2g3 A T 11: 3,492,151 S404C probably null Het
Plec A G 15: 76,194,360 V60A unknown Het
Prpsap2 A G 11: 61,752,910 S66P possibly damaging Het
Rarb A G 14: 16,436,804 L239P probably damaging Het
Ryr3 A T 2: 112,753,050 Y2845* probably null Het
Spta1 T C 1: 174,217,982 C1569R probably damaging Het
Stard13 G A 5: 151,062,650 S465L probably damaging Het
Tmub1 A T 5: 24,446,682 S80T probably benign Het
Trpv5 A G 6: 41,670,913 F322S probably damaging Het
Vmn2r5 G A 3: 64,503,782 A455V probably benign Het
Washc4 T A 10: 83,570,018 N459K probably damaging Het
Wdr11 C T 7: 129,605,713 R300* probably null Het
Zer1 A G 2: 30,103,418 F559L probably damaging Het
Zfat A T 15: 68,180,670 V425D probably damaging Het
Zfp738 G A 13: 67,669,791 L694F Het
Zfp839 C T 12: 110,868,843 A844V probably damaging Het
Other mutations in Gbp2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Gbp2b APN 3 142598312 missense probably damaging 1.00
IGL01892:Gbp2b APN 3 142603620 missense probably benign 0.03
IGL01989:Gbp2b APN 3 142611440 missense probably benign 0.19
IGL02019:Gbp2b APN 3 142606990 missense possibly damaging 0.52
IGL02338:Gbp2b APN 3 142604226 missense probably benign 0.09
IGL02657:Gbp2b APN 3 142604112 missense probably damaging 1.00
IGL03148:Gbp2b APN 3 142606881 missense probably benign 0.00
FR4304:Gbp2b UTSW 3 142603652 missense probably benign 0.00
FR4340:Gbp2b UTSW 3 142603652 missense probably benign 0.00
FR4342:Gbp2b UTSW 3 142603652 missense probably benign 0.00
FR4589:Gbp2b UTSW 3 142603652 missense probably benign 0.00
R0329:Gbp2b UTSW 3 142608176 missense probably benign 0.01
R0345:Gbp2b UTSW 3 142608183 missense probably damaging 1.00
R0358:Gbp2b UTSW 3 142606789 missense probably damaging 1.00
R0732:Gbp2b UTSW 3 142606978 missense probably benign
R1163:Gbp2b UTSW 3 142599096 missense probably damaging 1.00
R1550:Gbp2b UTSW 3 142606830 missense probably damaging 0.99
R1629:Gbp2b UTSW 3 142610974 missense possibly damaging 0.93
R1886:Gbp2b UTSW 3 142608302 missense probably benign
R1887:Gbp2b UTSW 3 142608302 missense probably benign
R2188:Gbp2b UTSW 3 142608279 missense probably benign 0.44
R2261:Gbp2b UTSW 3 142606735 missense probably benign 0.00
R3977:Gbp2b UTSW 3 142603709 missense probably benign 0.02
R4718:Gbp2b UTSW 3 142598995 missense probably damaging 1.00
R4788:Gbp2b UTSW 3 142611410 missense probably benign 0.21
R4807:Gbp2b UTSW 3 142598245 missense probably benign 0.02
R5042:Gbp2b UTSW 3 142611463 missense probably benign 0.03
R5087:Gbp2b UTSW 3 142598254 missense probably damaging 1.00
R5114:Gbp2b UTSW 3 142598185 missense probably damaging 1.00
R5414:Gbp2b UTSW 3 142599091 missense probably damaging 1.00
R5567:Gbp2b UTSW 3 142611365 missense possibly damaging 0.75
R5625:Gbp2b UTSW 3 142599045 missense probably damaging 1.00
R5685:Gbp2b UTSW 3 142608158 missense probably benign
R6030:Gbp2b UTSW 3 142603653 missense probably benign 0.00
R6030:Gbp2b UTSW 3 142603653 missense probably benign 0.00
R6408:Gbp2b UTSW 3 142618138 missense probably benign 0.00
R6500:Gbp2b UTSW 3 142611491 missense probably benign 0.06
R6581:Gbp2b UTSW 3 142608238 nonsense probably null
R6582:Gbp2b UTSW 3 142611040 missense possibly damaging 0.53
R6847:Gbp2b UTSW 3 142598179 missense probably damaging 0.96
R6923:Gbp2b UTSW 3 142600559 missense probably benign 0.01
R7120:Gbp2b UTSW 3 142606746 missense probably benign 0.01
R7255:Gbp2b UTSW 3 142608117 missense probably damaging 1.00
R7454:Gbp2b UTSW 3 142598159 missense possibly damaging 0.75
R7643:Gbp2b UTSW 3 142603609 missense probably benign 0.07
R8039:Gbp2b UTSW 3 142618164 missense probably benign 0.02
R8312:Gbp2b UTSW 3 142599051 missense probably benign
R8312:Gbp2b UTSW 3 142599054 missense probably damaging 0.96
R8391:Gbp2b UTSW 3 142604133 missense probably damaging 1.00
R8418:Gbp2b UTSW 3 142603705 missense probably benign 0.01
R8721:Gbp2b UTSW 3 142606944 missense possibly damaging 0.93
R8842:Gbp2b UTSW 3 142606815 missense probably benign
R8849:Gbp2b UTSW 3 142608152 missense probably benign 0.00
R8874:Gbp2b UTSW 3 142608279 missense probably benign 0.03
R8992:Gbp2b UTSW 3 142610969 missense probably benign 0.00
R9339:Gbp2b UTSW 3 142611417 missense probably benign 0.01
Z1177:Gbp2b UTSW 3 142604316 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TTGTCCCAGGGAAAGTACATG -3'
(R):5'- CATGATATCACAAACTTCCATTGAGCC -3'

Sequencing Primer
(F):5'- TCCCAGGGAAAGTACATGATCCATAG -3'
(R):5'- ACCTTTTCTCAGAGCCAGTGAAG -3'
Posted On 2021-08-02