Incidental Mutation 'R8896:Mdn1'
ID 678012
Institutional Source Beutler Lab
Gene Symbol Mdn1
Ensembl Gene ENSMUSG00000058006
Gene Name midasin AAA ATPase 1
Synonyms 4833432B22Rik, D4Abb1e, LOC213784
MMRRC Submission 068698-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8896 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 32657119-32775217 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 32678328 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 652 (P652L)
Ref Sequence ENSEMBL: ENSMUSP00000071569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071642] [ENSMUST00000178134]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000071642
AA Change: P652L

PolyPhen 2 Score 0.284 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000071569
Gene: ENSMUSG00000058006
AA Change: P652L

DomainStartEndE-ValueType
low complexity region 48 75 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
Pfam:AAA_5 324 459 7.4e-19 PFAM
AAA 666 908 1.06e-6 SMART
AAA 1072 1217 2.09e-1 SMART
AAA 1378 1544 8.27e-9 SMART
AAA 1740 1893 6.78e-2 SMART
AAA 2053 2309 1.62e0 SMART
low complexity region 3181 3193 N/A INTRINSIC
low complexity region 3541 3552 N/A INTRINSIC
low complexity region 3557 3565 N/A INTRINSIC
low complexity region 4189 4203 N/A INTRINSIC
low complexity region 4339 4353 N/A INTRINSIC
low complexity region 4672 4681 N/A INTRINSIC
low complexity region 4735 4756 N/A INTRINSIC
low complexity region 4769 4790 N/A INTRINSIC
low complexity region 4886 4905 N/A INTRINSIC
low complexity region 4924 4937 N/A INTRINSIC
coiled coil region 4957 4983 N/A INTRINSIC
low complexity region 5000 5017 N/A INTRINSIC
low complexity region 5176 5192 N/A INTRINSIC
low complexity region 5315 5329 N/A INTRINSIC
VWA 5375 5556 2.73e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178134
AA Change: P652L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136222
Gene: ENSMUSG00000058006
AA Change: P652L

DomainStartEndE-ValueType
low complexity region 48 75 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
Pfam:AAA_5 324 459 4.4e-19 PFAM
AAA 666 908 1.06e-6 SMART
AAA 1072 1217 2.09e-1 SMART
AAA 1378 1544 8.27e-9 SMART
AAA 1740 1893 6.78e-2 SMART
AAA 2053 2309 1.62e0 SMART
low complexity region 3181 3193 N/A INTRINSIC
low complexity region 3541 3552 N/A INTRINSIC
low complexity region 3557 3565 N/A INTRINSIC
low complexity region 4189 4203 N/A INTRINSIC
low complexity region 4339 4353 N/A INTRINSIC
low complexity region 4667 4676 N/A INTRINSIC
low complexity region 4730 4751 N/A INTRINSIC
low complexity region 4764 4785 N/A INTRINSIC
low complexity region 4881 4900 N/A INTRINSIC
low complexity region 4919 4932 N/A INTRINSIC
coiled coil region 4952 4978 N/A INTRINSIC
low complexity region 4992 5010 N/A INTRINSIC
low complexity region 5169 5185 N/A INTRINSIC
low complexity region 5308 5322 N/A INTRINSIC
VWA 5368 5549 2.73e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (73/73)
Allele List at MGI

All alleles(29) : Targeted, other(2) Gene trapped(27)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox4 T G 1: 58,291,233 (GRCm39) S784A probably benign Het
Ap3d1 T A 10: 80,552,425 (GRCm39) H581L probably benign Het
Atp11a T C 8: 12,899,781 (GRCm39) Y915H probably damaging Het
Atp4b T C 8: 13,437,514 (GRCm39) D213G probably benign Het
Bcl11a A G 11: 24,113,640 (GRCm39) S328G probably benign Het
Bean1 CT C 8: 104,908,664 (GRCm39) probably null Het
Cadps2 T A 6: 23,410,876 (GRCm39) Y685F probably damaging Het
Ccdc88b C T 19: 6,831,203 (GRCm39) A580T probably benign Het
Cdc42bpa GACAACA GACA 1: 179,958,373 (GRCm39) probably benign Het
Cep152 A T 2: 125,408,155 (GRCm39) V1396D possibly damaging Het
Ces1c T C 8: 93,833,254 (GRCm39) I404V probably benign Het
Cr2 A T 1: 194,851,581 (GRCm39) M137K possibly damaging Het
Cyp2d40 T C 15: 82,644,454 (GRCm39) Y257C unknown Het
Dennd1c T A 17: 57,381,512 (GRCm39) D116V probably damaging Het
Dph2 G A 4: 117,747,575 (GRCm39) R270* probably null Het
Dpp8 A C 9: 64,985,318 (GRCm39) H792P possibly damaging Het
Dusp29 T C 14: 21,736,763 (GRCm39) D113G probably benign Het
Efs T C 14: 55,157,756 (GRCm39) E185G possibly damaging Het
Eml3 A G 19: 8,914,056 (GRCm39) E480G probably damaging Het
Fam193a A G 5: 34,583,828 (GRCm39) T336A probably benign Het
Fermt1 C T 2: 132,783,852 (GRCm39) probably benign Het
Galnt4 T A 10: 98,945,955 (GRCm39) V560D probably damaging Het
Gbp2b C A 3: 142,309,327 (GRCm39) T146K probably damaging Het
Gbp5 C T 3: 142,211,308 (GRCm39) T346I probably damaging Het
Glrx G T 13: 75,995,317 (GRCm39) C79F probably damaging Het
Glt8d2 T A 10: 82,490,616 (GRCm39) T225S probably damaging Het
Grm3 A G 5: 9,562,483 (GRCm39) F456L possibly damaging Het
Gse1 T G 8: 121,303,185 (GRCm39) S1109A unknown Het
Gstp3 A T 19: 4,108,573 (GRCm39) L63Q probably damaging Het
Hapln3 G A 7: 78,767,239 (GRCm39) R267W probably benign Het
Herc4 T A 10: 63,147,286 (GRCm39) I801N possibly damaging Het
Ido1 G T 8: 25,077,880 (GRCm39) D153E probably benign Het
Itpr3 G A 17: 27,337,651 (GRCm39) probably benign Het
Kcnj9 T A 1: 172,153,360 (GRCm39) S255C probably damaging Het
Kpna3 T C 14: 61,629,294 (GRCm39) N39D probably benign Het
Krt39 A T 11: 99,409,095 (GRCm39) S269T probably damaging Het
Lfng G A 5: 140,598,978 (GRCm39) V296I probably benign Het
Lrit3 T A 3: 129,585,132 (GRCm39) I209F probably damaging Het
Map4k5 T A 12: 69,870,275 (GRCm39) D523V possibly damaging Het
Med30 G A 15: 52,584,516 (GRCm39) V145I possibly damaging Het
Megf6 T A 4: 154,326,860 (GRCm39) D163E probably damaging Het
Meltf T A 16: 31,709,522 (GRCm39) probably benign Het
Mindy4 T C 6: 55,255,223 (GRCm39) L567P probably benign Het
Mppe1 T C 18: 67,370,472 (GRCm39) D75G probably damaging Het
Muc4 C T 16: 32,754,673 (GRCm38) P1516S probably benign Het
Myo3b C A 2: 70,069,160 (GRCm39) F494L probably damaging Het
Nedd4l A G 18: 65,298,688 (GRCm39) T226A probably benign Het
Nod1 A G 6: 54,921,277 (GRCm39) V347A probably benign Het
Nup210 A T 6: 91,019,235 (GRCm39) probably null Het
Nup210l A G 3: 90,025,932 (GRCm39) R185G probably damaging Het
Oma1 T C 4: 103,210,829 (GRCm39) L445S probably damaging Het
Or13p10 A T 4: 118,523,502 (GRCm39) M263L probably benign Het
Or5ac20 A T 16: 59,104,452 (GRCm39) M136K probably damaging Het
Or8g36 A G 9: 39,422,770 (GRCm39) L82P probably damaging Het
Oxsm A T 14: 16,242,677 (GRCm38) F31I probably benign Het
Pdcd5 A T 7: 35,346,795 (GRCm39) M1K probably null Het
Pkd1l2 T C 8: 117,740,615 (GRCm39) T2161A possibly damaging Het
Pla2g3 A T 11: 3,442,151 (GRCm39) S404C probably null Het
Plec A G 15: 76,078,560 (GRCm39) V60A unknown Het
Prpsap2 A G 11: 61,643,736 (GRCm39) S66P possibly damaging Het
Rarb A G 14: 16,436,804 (GRCm38) L239P probably damaging Het
Ryr3 A T 2: 112,583,395 (GRCm39) Y2845* probably null Het
Spta1 T C 1: 174,045,548 (GRCm39) C1569R probably damaging Het
Stard13 G A 5: 150,986,115 (GRCm39) S465L probably damaging Het
Tmub1 A T 5: 24,651,680 (GRCm39) S80T probably benign Het
Trpv5 A G 6: 41,647,847 (GRCm39) F322S probably damaging Het
Vmn2r5 G A 3: 64,411,203 (GRCm39) A455V probably benign Het
Washc4 T A 10: 83,405,882 (GRCm39) N459K probably damaging Het
Wdr11 C T 7: 129,207,437 (GRCm39) R300* probably null Het
Zer1 A G 2: 29,993,430 (GRCm39) F559L probably damaging Het
Zfat A T 15: 68,052,519 (GRCm39) V425D probably damaging Het
Zfp738 G A 13: 67,817,910 (GRCm39) L694F Het
Zfp839 C T 12: 110,835,277 (GRCm39) A844V probably damaging Het
Other mutations in Mdn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Mdn1 APN 4 32,723,651 (GRCm39) missense probably damaging 1.00
IGL00426:Mdn1 APN 4 32,719,214 (GRCm39) missense possibly damaging 0.91
IGL00570:Mdn1 APN 4 32,735,719 (GRCm39) missense probably benign
IGL00573:Mdn1 APN 4 32,666,619 (GRCm39) critical splice donor site probably null
IGL00983:Mdn1 APN 4 32,735,525 (GRCm39) missense probably damaging 1.00
IGL01288:Mdn1 APN 4 32,730,864 (GRCm39) missense probably benign 0.00
IGL01359:Mdn1 APN 4 32,743,686 (GRCm39) missense probably benign 0.10
IGL01457:Mdn1 APN 4 32,715,922 (GRCm39) missense possibly damaging 0.82
IGL01530:Mdn1 APN 4 32,711,938 (GRCm39) splice site probably benign
IGL01684:Mdn1 APN 4 32,726,857 (GRCm39) missense probably benign
IGL01753:Mdn1 APN 4 32,708,483 (GRCm39) missense probably benign
IGL01901:Mdn1 APN 4 32,669,591 (GRCm39) missense probably damaging 1.00
IGL01952:Mdn1 APN 4 32,723,657 (GRCm39) missense possibly damaging 0.82
IGL01960:Mdn1 APN 4 32,758,393 (GRCm39) missense probably benign 0.14
IGL02019:Mdn1 APN 4 32,749,948 (GRCm39) missense possibly damaging 0.93
IGL02100:Mdn1 APN 4 32,715,708 (GRCm39) missense possibly damaging 0.90
IGL02117:Mdn1 APN 4 32,709,364 (GRCm39) missense probably benign 0.00
IGL02154:Mdn1 APN 4 32,740,395 (GRCm39) missense probably benign 0.35
IGL02216:Mdn1 APN 4 32,739,092 (GRCm39) missense probably benign 0.03
IGL02371:Mdn1 APN 4 32,676,860 (GRCm39) splice site probably benign
IGL02396:Mdn1 APN 4 32,700,120 (GRCm39) missense probably damaging 0.99
IGL02454:Mdn1 APN 4 32,694,674 (GRCm39) critical splice donor site probably null
IGL02502:Mdn1 APN 4 32,670,579 (GRCm39) missense possibly damaging 0.69
IGL02883:Mdn1 APN 4 32,763,199 (GRCm39) missense probably benign 0.05
IGL02946:Mdn1 APN 4 32,734,366 (GRCm39) missense probably damaging 0.98
IGL02950:Mdn1 APN 4 32,713,360 (GRCm39) splice site probably benign
IGL03076:Mdn1 APN 4 32,735,564 (GRCm39) missense probably damaging 0.97
IGL03129:Mdn1 APN 4 32,729,994 (GRCm39) missense possibly damaging 0.47
IGL03234:Mdn1 APN 4 32,732,842 (GRCm39) missense probably benign 0.06
3-1:Mdn1 UTSW 4 32,725,967 (GRCm39) critical splice donor site probably null
IGL03046:Mdn1 UTSW 4 32,694,495 (GRCm39) missense possibly damaging 0.73
P0035:Mdn1 UTSW 4 32,749,934 (GRCm39) missense probably benign 0.05
PIT4508001:Mdn1 UTSW 4 32,719,223 (GRCm39) missense probably damaging 0.97
PIT4618001:Mdn1 UTSW 4 32,746,527 (GRCm39) missense probably benign 0.20
R0008:Mdn1 UTSW 4 32,718,317 (GRCm39) missense possibly damaging 0.47
R0110:Mdn1 UTSW 4 32,738,619 (GRCm39) missense probably benign 0.20
R0125:Mdn1 UTSW 4 32,729,956 (GRCm39) missense probably damaging 0.98
R0257:Mdn1 UTSW 4 32,693,534 (GRCm39) missense probably damaging 0.99
R0266:Mdn1 UTSW 4 32,741,835 (GRCm39) missense probably damaging 0.99
R0349:Mdn1 UTSW 4 32,750,318 (GRCm39) missense probably damaging 1.00
R0362:Mdn1 UTSW 4 32,746,439 (GRCm39) critical splice acceptor site probably null
R0421:Mdn1 UTSW 4 32,684,707 (GRCm39) missense probably benign 0.39
R0450:Mdn1 UTSW 4 32,738,619 (GRCm39) missense probably benign 0.20
R0465:Mdn1 UTSW 4 32,699,204 (GRCm39) splice site probably benign
R0469:Mdn1 UTSW 4 32,738,619 (GRCm39) missense probably benign 0.20
R0477:Mdn1 UTSW 4 32,750,928 (GRCm39) missense probably benign 0.02
R0481:Mdn1 UTSW 4 32,767,182 (GRCm39) splice site probably benign
R0504:Mdn1 UTSW 4 32,698,916 (GRCm39) splice site probably benign
R0522:Mdn1 UTSW 4 32,672,837 (GRCm39) missense probably benign 0.09
R0550:Mdn1 UTSW 4 32,730,479 (GRCm39) missense probably benign 0.13
R0607:Mdn1 UTSW 4 32,732,829 (GRCm39) missense probably benign 0.36
R0607:Mdn1 UTSW 4 32,712,014 (GRCm39) missense probably damaging 1.00
R0664:Mdn1 UTSW 4 32,768,011 (GRCm39) nonsense probably null
R0701:Mdn1 UTSW 4 32,699,263 (GRCm39) missense probably benign 0.00
R0801:Mdn1 UTSW 4 32,668,895 (GRCm39) missense probably benign 0.04
R0841:Mdn1 UTSW 4 32,752,032 (GRCm39) missense probably benign 0.23
R0849:Mdn1 UTSW 4 32,741,835 (GRCm39) missense probably damaging 0.99
R0893:Mdn1 UTSW 4 32,701,713 (GRCm39) missense probably benign 0.01
R1114:Mdn1 UTSW 4 32,746,568 (GRCm39) critical splice donor site probably null
R1137:Mdn1 UTSW 4 32,694,511 (GRCm39) missense probably damaging 1.00
R1185:Mdn1 UTSW 4 32,735,576 (GRCm39) missense possibly damaging 0.94
R1185:Mdn1 UTSW 4 32,735,576 (GRCm39) missense possibly damaging 0.94
R1185:Mdn1 UTSW 4 32,735,576 (GRCm39) missense possibly damaging 0.94
R1257:Mdn1 UTSW 4 32,667,089 (GRCm39) critical splice acceptor site probably null
R1356:Mdn1 UTSW 4 32,700,334 (GRCm39) splice site probably benign
R1466:Mdn1 UTSW 4 32,730,788 (GRCm39) missense probably benign 0.28
R1466:Mdn1 UTSW 4 32,730,788 (GRCm39) missense probably benign 0.28
R1518:Mdn1 UTSW 4 32,739,977 (GRCm39) missense probably damaging 1.00
R1569:Mdn1 UTSW 4 32,723,501 (GRCm39) missense probably null 0.10
R1574:Mdn1 UTSW 4 32,722,315 (GRCm39) missense probably benign
R1574:Mdn1 UTSW 4 32,722,315 (GRCm39) missense probably benign
R1591:Mdn1 UTSW 4 32,700,092 (GRCm39) missense possibly damaging 0.65
R1678:Mdn1 UTSW 4 32,663,050 (GRCm39) missense probably damaging 0.99
R1696:Mdn1 UTSW 4 32,700,417 (GRCm39) missense possibly damaging 0.91
R1707:Mdn1 UTSW 4 32,693,504 (GRCm39) missense probably damaging 1.00
R1749:Mdn1 UTSW 4 32,773,952 (GRCm39) missense probably damaging 1.00
R1780:Mdn1 UTSW 4 32,700,103 (GRCm39) missense probably damaging 1.00
R1833:Mdn1 UTSW 4 32,720,761 (GRCm39) missense probably damaging 0.97
R1858:Mdn1 UTSW 4 32,730,881 (GRCm39) missense probably benign 0.17
R1870:Mdn1 UTSW 4 32,763,339 (GRCm39) missense probably damaging 1.00
R1887:Mdn1 UTSW 4 32,742,540 (GRCm39) missense probably damaging 1.00
R1909:Mdn1 UTSW 4 32,760,839 (GRCm39) small deletion probably benign
R2075:Mdn1 UTSW 4 32,716,058 (GRCm39) missense probably benign 0.03
R2103:Mdn1 UTSW 4 32,738,712 (GRCm39) missense possibly damaging 0.75
R2104:Mdn1 UTSW 4 32,743,843 (GRCm39) splice site probably null
R2110:Mdn1 UTSW 4 32,700,409 (GRCm39) missense probably damaging 1.00
R2111:Mdn1 UTSW 4 32,700,409 (GRCm39) missense probably damaging 1.00
R2206:Mdn1 UTSW 4 32,716,271 (GRCm39) missense possibly damaging 0.71
R2221:Mdn1 UTSW 4 32,763,306 (GRCm39) missense probably benign 0.37
R2240:Mdn1 UTSW 4 32,765,701 (GRCm39) missense possibly damaging 0.90
R2351:Mdn1 UTSW 4 32,750,010 (GRCm39) missense probably benign 0.21
R2421:Mdn1 UTSW 4 32,723,621 (GRCm39) missense probably damaging 0.96
R3036:Mdn1 UTSW 4 32,750,013 (GRCm39) missense probably damaging 0.99
R3434:Mdn1 UTSW 4 32,733,726 (GRCm39) critical splice donor site probably null
R3435:Mdn1 UTSW 4 32,733,726 (GRCm39) critical splice donor site probably null
R3783:Mdn1 UTSW 4 32,720,818 (GRCm39) missense probably benign 0.01
R3811:Mdn1 UTSW 4 32,693,506 (GRCm39) nonsense probably null
R3973:Mdn1 UTSW 4 32,722,363 (GRCm39) missense probably benign 0.00
R4154:Mdn1 UTSW 4 32,707,475 (GRCm39) missense probably damaging 0.96
R4372:Mdn1 UTSW 4 32,743,809 (GRCm39) missense probably benign 0.03
R4393:Mdn1 UTSW 4 32,754,482 (GRCm39) missense possibly damaging 0.48
R4438:Mdn1 UTSW 4 32,704,635 (GRCm39) missense probably damaging 1.00
R4471:Mdn1 UTSW 4 32,668,860 (GRCm39) missense probably benign 0.00
R4509:Mdn1 UTSW 4 32,715,883 (GRCm39) missense probably damaging 1.00
R4538:Mdn1 UTSW 4 32,722,334 (GRCm39) missense probably damaging 1.00
R4557:Mdn1 UTSW 4 32,754,437 (GRCm39) missense probably damaging 1.00
R4570:Mdn1 UTSW 4 32,741,812 (GRCm39) missense probably damaging 1.00
R4591:Mdn1 UTSW 4 32,707,636 (GRCm39) missense probably damaging 1.00
R4658:Mdn1 UTSW 4 32,730,749 (GRCm39) splice site probably null
R4667:Mdn1 UTSW 4 32,679,572 (GRCm39) missense probably damaging 1.00
R4684:Mdn1 UTSW 4 32,666,430 (GRCm39) missense probably damaging 1.00
R4778:Mdn1 UTSW 4 32,683,583 (GRCm39) nonsense probably null
R4807:Mdn1 UTSW 4 32,685,651 (GRCm39) splice site probably null
R4923:Mdn1 UTSW 4 32,671,608 (GRCm39) missense possibly damaging 0.89
R4951:Mdn1 UTSW 4 32,707,459 (GRCm39) missense probably damaging 1.00
R4963:Mdn1 UTSW 4 32,756,512 (GRCm39) missense probably benign 0.00
R4971:Mdn1 UTSW 4 32,739,827 (GRCm39) missense probably damaging 1.00
R4973:Mdn1 UTSW 4 32,734,418 (GRCm39) missense probably benign 0.01
R5122:Mdn1 UTSW 4 32,670,593 (GRCm39) missense probably damaging 1.00
R5159:Mdn1 UTSW 4 32,774,008 (GRCm39) missense possibly damaging 0.93
R5164:Mdn1 UTSW 4 32,759,011 (GRCm39) splice site probably null
R5215:Mdn1 UTSW 4 32,741,418 (GRCm39) missense possibly damaging 0.78
R5217:Mdn1 UTSW 4 32,723,690 (GRCm39) missense probably damaging 0.98
R5219:Mdn1 UTSW 4 32,723,690 (GRCm39) missense probably damaging 0.98
R5365:Mdn1 UTSW 4 32,723,690 (GRCm39) missense probably damaging 0.98
R5366:Mdn1 UTSW 4 32,723,690 (GRCm39) missense probably damaging 0.98
R5368:Mdn1 UTSW 4 32,723,690 (GRCm39) missense probably damaging 0.98
R5445:Mdn1 UTSW 4 32,723,690 (GRCm39) missense probably damaging 0.98
R5462:Mdn1 UTSW 4 32,720,897 (GRCm39) missense probably benign
R5522:Mdn1 UTSW 4 32,685,783 (GRCm39) missense probably damaging 1.00
R5525:Mdn1 UTSW 4 32,767,961 (GRCm39) missense possibly damaging 0.73
R5578:Mdn1 UTSW 4 32,728,167 (GRCm39) missense probably benign 0.04
R5605:Mdn1 UTSW 4 32,765,664 (GRCm39) missense probably benign
R5621:Mdn1 UTSW 4 32,716,371 (GRCm39) missense possibly damaging 0.46
R5636:Mdn1 UTSW 4 32,695,480 (GRCm39) missense probably damaging 1.00
R5650:Mdn1 UTSW 4 32,667,467 (GRCm39) splice site probably null
R5780:Mdn1 UTSW 4 32,722,950 (GRCm39) missense probably benign 0.02
R5838:Mdn1 UTSW 4 32,754,547 (GRCm39) missense probably damaging 0.99
R5857:Mdn1 UTSW 4 32,670,646 (GRCm39) missense probably benign 0.09
R5895:Mdn1 UTSW 4 32,695,400 (GRCm39) missense probably damaging 1.00
R5943:Mdn1 UTSW 4 32,678,330 (GRCm39) missense probably damaging 1.00
R6008:Mdn1 UTSW 4 32,741,073 (GRCm39) missense probably damaging 1.00
R6013:Mdn1 UTSW 4 32,715,713 (GRCm39) missense probably damaging 1.00
R6075:Mdn1 UTSW 4 32,689,581 (GRCm39) missense possibly damaging 0.48
R6151:Mdn1 UTSW 4 32,684,735 (GRCm39) missense probably damaging 1.00
R6163:Mdn1 UTSW 4 32,716,040 (GRCm39) missense probably damaging 1.00
R6181:Mdn1 UTSW 4 32,715,953 (GRCm39) missense probably damaging 1.00
R6211:Mdn1 UTSW 4 32,696,269 (GRCm39) missense probably benign 0.12
R6249:Mdn1 UTSW 4 32,708,484 (GRCm39) missense possibly damaging 0.85
R6251:Mdn1 UTSW 4 32,748,590 (GRCm39) missense probably benign 0.13
R6253:Mdn1 UTSW 4 32,749,593 (GRCm39) missense probably benign 0.25
R6273:Mdn1 UTSW 4 32,715,979 (GRCm39) missense probably benign 0.01
R6297:Mdn1 UTSW 4 32,730,054 (GRCm39) nonsense probably null
R6384:Mdn1 UTSW 4 32,670,607 (GRCm39) missense probably damaging 1.00
R6463:Mdn1 UTSW 4 32,773,308 (GRCm39) missense probably damaging 1.00
R6528:Mdn1 UTSW 4 32,713,780 (GRCm39) missense probably damaging 1.00
R6688:Mdn1 UTSW 4 32,774,041 (GRCm39) missense possibly damaging 0.74
R6762:Mdn1 UTSW 4 32,676,786 (GRCm39) missense possibly damaging 0.50
R6794:Mdn1 UTSW 4 32,741,893 (GRCm39) missense probably damaging 1.00
R6894:Mdn1 UTSW 4 32,748,614 (GRCm39) missense possibly damaging 0.75
R6935:Mdn1 UTSW 4 32,774,041 (GRCm39) missense possibly damaging 0.74
R6980:Mdn1 UTSW 4 32,726,942 (GRCm39) critical splice donor site probably null
R6995:Mdn1 UTSW 4 32,733,374 (GRCm39) missense probably benign 0.03
R7048:Mdn1 UTSW 4 32,767,969 (GRCm39) missense probably benign 0.00
R7082:Mdn1 UTSW 4 32,762,341 (GRCm39) missense probably benign
R7158:Mdn1 UTSW 4 32,725,121 (GRCm39) missense probably benign 0.09
R7166:Mdn1 UTSW 4 32,746,446 (GRCm39) missense probably damaging 1.00
R7168:Mdn1 UTSW 4 32,719,184 (GRCm39) missense probably damaging 1.00
R7175:Mdn1 UTSW 4 32,694,634 (GRCm39) missense probably damaging 1.00
R7195:Mdn1 UTSW 4 32,701,823 (GRCm39) missense probably damaging 1.00
R7250:Mdn1 UTSW 4 32,695,427 (GRCm39) missense probably damaging 1.00
R7274:Mdn1 UTSW 4 32,725,944 (GRCm39) missense probably benign 0.12
R7330:Mdn1 UTSW 4 32,723,685 (GRCm39) missense probably benign 0.16
R7363:Mdn1 UTSW 4 32,691,729 (GRCm39) missense probably damaging 0.99
R7369:Mdn1 UTSW 4 32,773,375 (GRCm39) missense probably damaging 0.99
R7452:Mdn1 UTSW 4 32,739,030 (GRCm39) missense possibly damaging 0.87
R7523:Mdn1 UTSW 4 32,667,270 (GRCm39) critical splice acceptor site probably null
R7594:Mdn1 UTSW 4 32,696,359 (GRCm39) missense probably benign 0.27
R7605:Mdn1 UTSW 4 32,694,599 (GRCm39) missense probably damaging 1.00
R7661:Mdn1 UTSW 4 32,691,229 (GRCm39) missense probably benign 0.08
R7689:Mdn1 UTSW 4 32,739,912 (GRCm39) missense probably damaging 1.00
R7699:Mdn1 UTSW 4 32,741,344 (GRCm39) missense probably damaging 1.00
R7700:Mdn1 UTSW 4 32,741,344 (GRCm39) missense probably damaging 1.00
R7714:Mdn1 UTSW 4 32,722,360 (GRCm39) missense possibly damaging 0.75
R7718:Mdn1 UTSW 4 32,718,420 (GRCm39) missense probably damaging 1.00
R7762:Mdn1 UTSW 4 32,734,421 (GRCm39) missense probably benign
R7787:Mdn1 UTSW 4 32,741,794 (GRCm39) missense probably damaging 1.00
R8111:Mdn1 UTSW 4 32,674,003 (GRCm39) missense possibly damaging 0.81
R8222:Mdn1 UTSW 4 32,707,477 (GRCm39) missense probably benign 0.09
R8246:Mdn1 UTSW 4 32,657,284 (GRCm39) missense probably benign 0.06
R8267:Mdn1 UTSW 4 32,742,485 (GRCm39) missense possibly damaging 0.82
R8286:Mdn1 UTSW 4 32,731,960 (GRCm39) missense possibly damaging 0.91
R8305:Mdn1 UTSW 4 32,725,107 (GRCm39) missense probably benign
R8318:Mdn1 UTSW 4 32,735,897 (GRCm39) critical splice donor site probably null
R8379:Mdn1 UTSW 4 32,756,453 (GRCm39) missense probably null 1.00
R8384:Mdn1 UTSW 4 32,765,680 (GRCm39) missense probably benign 0.05
R8514:Mdn1 UTSW 4 32,739,857 (GRCm39) missense probably damaging 1.00
R8560:Mdn1 UTSW 4 32,743,830 (GRCm39) missense probably benign 0.08
R8672:Mdn1 UTSW 4 32,768,793 (GRCm39) missense probably damaging 1.00
R8708:Mdn1 UTSW 4 32,725,854 (GRCm39) missense probably damaging 1.00
R8769:Mdn1 UTSW 4 32,751,390 (GRCm39) missense probably damaging 0.97
R8918:Mdn1 UTSW 4 32,744,579 (GRCm39) nonsense probably null
R8920:Mdn1 UTSW 4 32,719,280 (GRCm39) missense probably damaging 1.00
R8966:Mdn1 UTSW 4 32,672,837 (GRCm39) nonsense probably null
R8997:Mdn1 UTSW 4 32,773,275 (GRCm39) missense probably damaging 1.00
R9120:Mdn1 UTSW 4 32,701,814 (GRCm39) missense probably damaging 1.00
R9129:Mdn1 UTSW 4 32,676,812 (GRCm39) missense probably benign 0.24
R9131:Mdn1 UTSW 4 32,762,275 (GRCm39) missense possibly damaging 0.69
R9200:Mdn1 UTSW 4 32,760,791 (GRCm39) missense probably benign 0.00
R9226:Mdn1 UTSW 4 32,694,612 (GRCm39) missense probably benign 0.25
R9235:Mdn1 UTSW 4 32,739,122 (GRCm39) missense probably benign 0.10
R9293:Mdn1 UTSW 4 32,707,579 (GRCm39) missense probably damaging 1.00
R9315:Mdn1 UTSW 4 32,760,911 (GRCm39) missense probably benign 0.00
R9338:Mdn1 UTSW 4 32,666,536 (GRCm39) missense probably benign 0.00
R9353:Mdn1 UTSW 4 32,693,504 (GRCm39) missense probably damaging 1.00
R9393:Mdn1 UTSW 4 32,713,825 (GRCm39) missense
R9420:Mdn1 UTSW 4 32,678,414 (GRCm39) missense probably damaging 1.00
R9475:Mdn1 UTSW 4 32,739,849 (GRCm39) missense possibly damaging 0.65
R9583:Mdn1 UTSW 4 32,741,372 (GRCm39) missense probably damaging 1.00
R9600:Mdn1 UTSW 4 32,684,723 (GRCm39) nonsense probably null
R9640:Mdn1 UTSW 4 32,754,539 (GRCm39) missense probably damaging 1.00
R9688:Mdn1 UTSW 4 32,745,590 (GRCm39) missense probably damaging 1.00
R9744:Mdn1 UTSW 4 32,715,711 (GRCm39) missense possibly damaging 0.91
X0066:Mdn1 UTSW 4 32,739,030 (GRCm39) missense probably damaging 1.00
Z1176:Mdn1 UTSW 4 32,696,244 (GRCm39) missense probably damaging 1.00
Z1176:Mdn1 UTSW 4 32,668,944 (GRCm39) missense probably damaging 1.00
Z1176:Mdn1 UTSW 4 32,667,102 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTCCAACACTTAGGAAAAGCTTG -3'
(R):5'- ACTTGTTCACCCAATCCGGC -3'

Sequencing Primer
(F):5'- CACTTAGGAAAAGCTTGAAGCC -3'
(R):5'- CCAATCCGGCCCTGCTC -3'
Posted On 2021-08-02