Incidental Mutation 'R8896:Fam193a'
ID 678019
Institutional Source Beutler Lab
Gene Symbol Fam193a
Ensembl Gene ENSMUSG00000037210
Gene Name family with sequence similarity 193, member A
Synonyms
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001243123.1; MGI:2447768

Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock # R8896 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 34369933-34486456 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34426484 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 336 (T336A)
Ref Sequence ENSEMBL: ENSMUSP00000138082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094867] [ENSMUST00000180376] [ENSMUST00000202503]
AlphaFold Q8CGI1
Predicted Effect probably benign
Transcript: ENSMUST00000094867
AA Change: T50A

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000092463
Gene: ENSMUSG00000037210
AA Change: T50A

DomainStartEndE-ValueType
coiled coil region 113 141 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
low complexity region 347 368 N/A INTRINSIC
low complexity region 584 593 N/A INTRINSIC
low complexity region 608 643 N/A INTRINSIC
low complexity region 676 691 N/A INTRINSIC
low complexity region 763 785 N/A INTRINSIC
low complexity region 819 832 N/A INTRINSIC
coiled coil region 879 946 N/A INTRINSIC
low complexity region 980 993 N/A INTRINSIC
low complexity region 1052 1063 N/A INTRINSIC
low complexity region 1155 1166 N/A INTRINSIC
Pfam:FAM193_C 1174 1230 3.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180376
AA Change: T336A

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000138082
Gene: ENSMUSG00000037210
AA Change: T336A

DomainStartEndE-ValueType
SCOP:d1gvp__ 70 93 4e-3 SMART
coiled coil region 399 427 N/A INTRINSIC
low complexity region 544 556 N/A INTRINSIC
low complexity region 633 654 N/A INTRINSIC
low complexity region 870 879 N/A INTRINSIC
low complexity region 894 929 N/A INTRINSIC
low complexity region 962 977 N/A INTRINSIC
low complexity region 1049 1071 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
coiled coil region 1165 1232 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
low complexity region 1338 1349 N/A INTRINSIC
low complexity region 1441 1452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202503
SMART Domains Protein: ENSMUSP00000143922
Gene: ENSMUSG00000037210

DomainStartEndE-ValueType
coiled coil region 29 57 N/A INTRINSIC
low complexity region 178 189 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (73/73)
Allele List at MGI

All alleles(19) : Gene trapped(19)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aox4 T G 1: 58,252,074 S784A probably benign Het
Ap3d1 T A 10: 80,716,591 H581L probably benign Het
Atp11a T C 8: 12,849,781 Y915H probably damaging Het
Atp4b T C 8: 13,387,514 D213G probably benign Het
Bcl11a A G 11: 24,163,640 S328G probably benign Het
Bean1 CT C 8: 104,182,032 probably null Het
Cadps2 T A 6: 23,410,877 Y685F probably damaging Het
Ccdc88b C T 19: 6,853,835 A580T probably benign Het
Cdc42bpa GACAACA GACA 1: 180,130,808 probably benign Het
Cep152 A T 2: 125,566,235 V1396D possibly damaging Het
Ces1c T C 8: 93,106,626 I404V probably benign Het
Cr2 A T 1: 195,169,273 M137K possibly damaging Het
Cyp2d40 T C 15: 82,760,253 Y257C unknown Het
Dennd1c T A 17: 57,074,512 D116V probably damaging Het
Dph2 G A 4: 117,890,378 R270* probably null Het
Dpp8 A C 9: 65,078,036 H792P possibly damaging Het
Dupd1 T C 14: 21,686,695 D113G probably benign Het
Efs T C 14: 54,920,299 E185G possibly damaging Het
Eml3 A G 19: 8,936,692 E480G probably damaging Het
Fermt1 C T 2: 132,941,932 probably benign Het
Galnt4 T A 10: 99,110,093 V560D probably damaging Het
Gbp2b C A 3: 142,603,566 T146K probably damaging Het
Gbp5 C T 3: 142,505,547 T346I probably damaging Het
Glrx G T 13: 75,847,198 C79F probably damaging Het
Glt8d2 T A 10: 82,654,782 T225S probably damaging Het
Grm3 A G 5: 9,512,483 F456L possibly damaging Het
Gse1 T G 8: 120,576,446 S1109A unknown Het
Gstp3 A T 19: 4,058,573 L63Q probably damaging Het
Hapln3 G A 7: 79,117,491 R267W probably benign Het
Herc4 T A 10: 63,311,507 I801N possibly damaging Het
Ido1 G T 8: 24,587,864 D153E probably benign Het
Itpr3 G A 17: 27,118,677 probably benign Het
Kcnj9 T A 1: 172,325,793 S255C probably damaging Het
Kpna3 T C 14: 61,391,845 N39D probably benign Het
Krt39 A T 11: 99,518,269 S269T probably damaging Het
Lfng G A 5: 140,613,223 V296I probably benign Het
Lrit3 T A 3: 129,791,483 I209F probably damaging Het
Map4k5 T A 12: 69,823,501 D523V possibly damaging Het
Mdn1 C T 4: 32,678,328 P652L probably benign Het
Med30 G A 15: 52,721,120 V145I possibly damaging Het
Megf6 T A 4: 154,242,403 D163E probably damaging Het
Meltf T A 16: 31,890,704 probably benign Het
Mindy4 T C 6: 55,278,238 L567P probably benign Het
Mppe1 T C 18: 67,237,401 D75G probably damaging Het
Muc4 C T 16: 32,754,673 P1516S probably benign Het
Myo3b C A 2: 70,238,816 F494L probably damaging Het
Nedd4l A G 18: 65,165,617 T226A probably benign Het
Nod1 A G 6: 54,944,292 V347A probably benign Het
Nup210 A T 6: 91,042,253 probably null Het
Nup210l A G 3: 90,118,625 R185G probably damaging Het
Olfr202 A T 16: 59,284,089 M136K probably damaging Het
Olfr62 A T 4: 118,666,305 M263L probably benign Het
Olfr957 A G 9: 39,511,474 L82P probably damaging Het
Oma1 T C 4: 103,353,632 L445S probably damaging Het
Oxsm A T 14: 16,242,677 F31I probably benign Het
Pdcd5 A T 7: 35,647,370 M1K probably null Het
Pkd1l2 T C 8: 117,013,876 T2161A possibly damaging Het
Pla2g3 A T 11: 3,492,151 S404C probably null Het
Plec A G 15: 76,194,360 V60A unknown Het
Prpsap2 A G 11: 61,752,910 S66P possibly damaging Het
Rarb A G 14: 16,436,804 L239P probably damaging Het
Ryr3 A T 2: 112,753,050 Y2845* probably null Het
Spta1 T C 1: 174,217,982 C1569R probably damaging Het
Stard13 G A 5: 151,062,650 S465L probably damaging Het
Tmub1 A T 5: 24,446,682 S80T probably benign Het
Trpv5 A G 6: 41,670,913 F322S probably damaging Het
Vmn2r5 G A 3: 64,503,782 A455V probably benign Het
Washc4 T A 10: 83,570,018 N459K probably damaging Het
Wdr11 C T 7: 129,605,713 R300* probably null Het
Zer1 A G 2: 30,103,418 F559L probably damaging Het
Zfat A T 15: 68,180,670 V425D probably damaging Het
Zfp738 G A 13: 67,669,791 L694F Het
Zfp839 C T 12: 110,868,843 A844V probably damaging Het
Other mutations in Fam193a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01981:Fam193a APN 5 34431193 missense probably damaging 0.99
IGL02111:Fam193a APN 5 34410657 missense possibly damaging 0.72
IGL02139:Fam193a APN 5 34444737 missense probably benign 0.12
IGL02218:Fam193a APN 5 34443588 missense possibly damaging 0.68
BB010:Fam193a UTSW 5 34466195 missense possibly damaging 0.53
BB020:Fam193a UTSW 5 34466195 missense possibly damaging 0.53
P0017:Fam193a UTSW 5 34440463 missense probably damaging 1.00
PIT4418001:Fam193a UTSW 5 34440535 missense probably damaging 0.97
R0172:Fam193a UTSW 5 34465613 missense probably damaging 0.97
R0413:Fam193a UTSW 5 34466208 missense possibly damaging 0.83
R0512:Fam193a UTSW 5 34426391 missense probably damaging 1.00
R0735:Fam193a UTSW 5 34439378 missense possibly damaging 0.85
R0764:Fam193a UTSW 5 34443341 missense probably damaging 0.99
R0904:Fam193a UTSW 5 34462143 missense probably damaging 1.00
R1756:Fam193a UTSW 5 34466292 missense possibly damaging 0.91
R1765:Fam193a UTSW 5 34436497 missense probably damaging 0.99
R1766:Fam193a UTSW 5 34462131 missense probably damaging 0.99
R1845:Fam193a UTSW 5 34443372 missense possibly damaging 0.91
R2051:Fam193a UTSW 5 34462150 missense probably benign 0.19
R2483:Fam193a UTSW 5 34465758 missense possibly damaging 0.96
R3014:Fam193a UTSW 5 34465672 missense probably benign 0.33
R4523:Fam193a UTSW 5 34443371 missense probably benign 0.07
R4723:Fam193a UTSW 5 34420786 missense probably benign 0.04
R4823:Fam193a UTSW 5 34459028 missense probably damaging 1.00
R4826:Fam193a UTSW 5 34436531 missense probably damaging 1.00
R4863:Fam193a UTSW 5 34466205 missense possibly damaging 0.86
R5331:Fam193a UTSW 5 34465571 splice site probably null
R5364:Fam193a UTSW 5 34466253 missense probably benign 0.01
R5564:Fam193a UTSW 5 34420855 missense probably damaging 0.98
R5580:Fam193a UTSW 5 34420788 missense probably benign 0.33
R5784:Fam193a UTSW 5 34466223 missense probably damaging 0.99
R5933:Fam193a UTSW 5 34465680 missense probably damaging 0.98
R5949:Fam193a UTSW 5 34440472 missense possibly damaging 0.82
R6106:Fam193a UTSW 5 34459030 missense possibly damaging 0.67
R6181:Fam193a UTSW 5 34443540 splice site probably null
R7095:Fam193a UTSW 5 34458034 missense probably damaging 0.99
R7109:Fam193a UTSW 5 34465821 missense possibly damaging 0.86
R7344:Fam193a UTSW 5 34485730 missense possibly damaging 0.71
R7401:Fam193a UTSW 5 34465635 missense possibly damaging 0.72
R7453:Fam193a UTSW 5 34464116 missense possibly damaging 0.72
R7456:Fam193a UTSW 5 34420788 missense possibly damaging 0.86
R7648:Fam193a UTSW 5 34431182 missense probably damaging 0.99
R7768:Fam193a UTSW 5 34465791 missense possibly damaging 0.85
R7783:Fam193a UTSW 5 34431180 missense probably damaging 0.99
R7818:Fam193a UTSW 5 34465653 missense possibly damaging 0.72
R7852:Fam193a UTSW 5 34410817 missense probably benign 0.01
R7853:Fam193a UTSW 5 34440129 missense probably benign 0.12
R7894:Fam193a UTSW 5 34440533 missense possibly damaging 0.92
R7933:Fam193a UTSW 5 34466195 missense possibly damaging 0.53
R7957:Fam193a UTSW 5 34462086 missense probably damaging 1.00
R8191:Fam193a UTSW 5 34440573 missense probably damaging 0.96
R8281:Fam193a UTSW 5 34443436 missense unknown
R8554:Fam193a UTSW 5 34475771 missense probably benign 0.05
R8743:Fam193a UTSW 5 34420157 critical splice donor site probably null
R8821:Fam193a UTSW 5 34459030 missense probably benign 0.01
R8831:Fam193a UTSW 5 34459030 missense probably benign 0.01
R8943:Fam193a UTSW 5 34440452 missense probably benign 0.01
R9026:Fam193a UTSW 5 34459192 missense possibly damaging 0.91
R9182:Fam193a UTSW 5 34466017 missense possibly damaging 0.72
R9210:Fam193a UTSW 5 34440137 missense probably benign 0.01
R9212:Fam193a UTSW 5 34440137 missense probably benign 0.01
R9291:Fam193a UTSW 5 34436491 missense probably damaging 1.00
Z1088:Fam193a UTSW 5 34420895 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAACAAGCCCGGGAATATGTG -3'
(R):5'- TGGCTCCTGGACATTAATTCTC -3'

Sequencing Primer
(F):5'- TGCTGGAGATGAAGGTCCGC -3'
(R):5'- AAATGCTTCTCTCTGCTAGCAAATTC -3'
Posted On 2021-08-02