Incidental Mutation 'R8897:Thap12'
ID 678101
Institutional Source Beutler Lab
Gene Symbol Thap12
Ensembl Gene ENSMUSG00000030753
Gene Name THAP domain containing 12
Synonyms Prkrir, Dap4, 2900052B10Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock # R8897 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 98703103-98718062 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 98715327 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 234 (M234T)
Ref Sequence ENSEMBL: ENSMUSP00000033009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033009] [ENSMUST00000126356] [ENSMUST00000153566]
AlphaFold Q9CUX1
Predicted Effect probably benign
Transcript: ENSMUST00000033009
AA Change: M234T

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000033009
Gene: ENSMUSG00000030753
AA Change: M234T

DomainStartEndE-ValueType
THAP 3 92 8.38e-22 SMART
DM3 21 91 1.49e-20 SMART
Pfam:DUF4371 112 338 1.9e-22 PFAM
low complexity region 433 445 N/A INTRINSIC
Pfam:Dimer_Tnp_hAT 631 726 6.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126356
SMART Domains Protein: ENSMUSP00000118403
Gene: ENSMUSG00000030753

DomainStartEndE-ValueType
THAP 3 78 3.21e-9 SMART
DM3 21 78 1.89e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153566
SMART Domains Protein: ENSMUSP00000118736
Gene: ENSMUSG00000030753

DomainStartEndE-ValueType
THAP 3 92 8.38e-22 SMART
DM3 21 91 1.49e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T A 18: 6,635,934 L329Q probably damaging Het
5430419D17Rik T C 7: 131,265,837 M1409T unknown Het
Adam26b A T 8: 43,520,972 M331K possibly damaging Het
Ak3 T C 19: 29,047,718 S38G probably damaging Het
Ankrd10 A T 8: 11,615,788 C271S possibly damaging Het
Ap1s3 A G 1: 79,623,777 Y66H probably damaging Het
Ap4b1 A T 3: 103,821,749 I736L probably benign Het
Arpp19 T A 9: 75,056,666 M67K possibly damaging Het
Brf1 T G 12: 112,987,969 H130P probably damaging Het
Cacna1s C G 1: 136,117,654 T1680S probably benign Het
Cckar C T 5: 53,707,241 probably benign Het
Cd93 T C 2: 148,441,612 K605E probably benign Het
Ces1h C T 8: 93,353,465 V474I unknown Het
Cfap70 A T 14: 20,443,601 probably null Het
Ch25h G A 19: 34,475,041 T29I possibly damaging Het
Csmd3 T A 15: 48,359,343 T329S probably benign Het
Cux1 T C 5: 136,286,769 N1139S probably damaging Het
Cyp2j6 G T 4: 96,525,850 H393N probably benign Het
Cyp8b1 C A 9: 121,916,292 probably benign Het
Dchs2 T G 3: 83,129,413 L489R probably damaging Het
Dip2a T C 10: 76,274,264 T1173A probably benign Het
Exoc3l2 T G 7: 19,470,006 probably null Het
Fastkd3 G A 13: 68,584,184 R208H probably damaging Het
Fbxo16 C A 14: 65,293,838 R64S probably benign Het
Frem3 A T 8: 80,612,790 I571F probably damaging Het
Ftsj3 T A 11: 106,253,776 D129V probably damaging Het
Gm6370 A G 5: 146,493,637 T211A probably benign Het
Gpr171 A T 3: 59,097,695 S220T probably benign Het
Gsta3 T C 1: 21,260,146 I124T probably benign Het
Hydin A G 8: 110,589,480 I4335V probably benign Het
Ift80 T C 3: 68,950,476 I279V probably benign Het
Ighv1-13 T A 12: 114,630,819 M47K unknown Het
Il22ra2 A G 10: 19,631,653 N138S probably damaging Het
Impact A G 18: 12,990,494 D298G probably benign Het
Ipo7 T C 7: 110,044,736 probably null Het
Kif5b T C 18: 6,225,437 N198D probably damaging Het
Klhl36 A G 8: 119,870,540 T327A probably benign Het
Lepr A G 4: 101,792,036 N878S probably damaging Het
Lpxn T A 19: 12,825,161 F244L probably damaging Het
Lrriq4 C A 3: 30,655,658 L384I probably damaging Het
Ltbp4 A C 7: 27,326,694 I629S probably benign Het
Lypd5 T C 7: 24,351,590 V42A probably benign Het
Mc4r A G 18: 66,859,233 S270P probably damaging Het
Mctp2 T G 7: 72,259,563 M1L probably benign Het
Myh4 G A 11: 67,246,536 E528K possibly damaging Het
Nes T A 3: 87,979,346 H1637Q possibly damaging Het
Olfr1002 A T 2: 85,647,843 H159Q possibly damaging Het
Olfr1303 T C 2: 111,814,231 D165G probably benign Het
Olfr918 C T 9: 38,672,851 V198I probably damaging Het
Pan3 T C 5: 147,450,662 M147T probably benign Het
Pcdhga6 G T 18: 37,708,589 R454L probably benign Het
Pdss2 A G 10: 43,345,667 S192G probably damaging Het
Pld6 A T 11: 59,787,556 M27K probably benign Het
Plec C T 15: 76,173,398 R4113H probably damaging Het
Ptprk T C 10: 28,591,957 S1379P probably damaging Het
Rapgef2 T C 3: 79,112,259 H35R probably damaging Het
Rasgrp2 A G 19: 6,403,070 T75A probably benign Het
Rexo1 A G 10: 80,542,603 L1172P probably damaging Het
Rfx7 C T 9: 72,617,841 S771L probably benign Het
Rpap3 A G 15: 97,688,117 I331T probably benign Het
Scn2a A G 2: 65,715,658 probably null Het
Sec23ip T A 7: 128,752,743 V241D probably benign Het
Sez6l C A 5: 112,440,878 Q656H possibly damaging Het
Sh3gl2 A T 4: 85,355,360 I50L probably benign Het
Tab2 T C 10: 7,911,133 D605G probably damaging Het
Tas2r110 T A 6: 132,868,411 V135D probably damaging Het
Trhr C A 15: 44,197,340 D85E probably benign Het
Trim67 A G 8: 124,825,979 I607V probably benign Het
Trpm4 C T 7: 45,310,631 C760Y probably benign Het
Ttll9 T C 2: 153,002,921 V403A probably damaging Het
Uhrf1 T C 17: 56,310,817 Y180H probably damaging Het
Unc119b C T 5: 115,134,918 probably benign Het
Vmn2r44 T A 7: 8,378,243 D217V probably damaging Het
Zfp521 C A 18: 13,846,080 L425F probably damaging Het
Zscan4-ps3 A T 7: 11,612,840 R268* probably null Het
Other mutations in Thap12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Thap12 APN 7 98716137 missense possibly damaging 0.82
IGL01145:Thap12 APN 7 98712903 makesense probably null
IGL01973:Thap12 APN 7 98716499 missense possibly damaging 0.58
IGL02404:Thap12 APN 7 98710133 missense probably damaging 1.00
H8562:Thap12 UTSW 7 98715107 missense probably damaging 0.98
PIT4453001:Thap12 UTSW 7 98715038 missense probably benign 0.00
R0090:Thap12 UTSW 7 98715893 missense probably damaging 1.00
R0254:Thap12 UTSW 7 98715281 missense probably benign 0.03
R1344:Thap12 UTSW 7 98716830 missense probably damaging 0.97
R1384:Thap12 UTSW 7 98703438 missense probably damaging 0.98
R1418:Thap12 UTSW 7 98716830 missense probably damaging 0.97
R1448:Thap12 UTSW 7 98716023 missense probably benign 0.01
R1493:Thap12 UTSW 7 98715438 missense probably benign 0.30
R1906:Thap12 UTSW 7 98716740 missense probably damaging 1.00
R1932:Thap12 UTSW 7 98716838 missense possibly damaging 0.77
R1992:Thap12 UTSW 7 98716365 missense possibly damaging 0.68
R2044:Thap12 UTSW 7 98716620 missense probably damaging 1.00
R2092:Thap12 UTSW 7 98716449 missense possibly damaging 0.70
R2160:Thap12 UTSW 7 98710126 missense probably damaging 0.97
R3850:Thap12 UTSW 7 98716663 missense probably damaging 1.00
R4086:Thap12 UTSW 7 98716494 missense possibly damaging 0.94
R4162:Thap12 UTSW 7 98710078 intron probably benign
R4554:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4555:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4556:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4557:Thap12 UTSW 7 98715845 missense probably benign 0.00
R4659:Thap12 UTSW 7 98710091 intron probably benign
R4734:Thap12 UTSW 7 98715954 missense probably damaging 0.98
R4734:Thap12 UTSW 7 98715955 nonsense probably null
R5794:Thap12 UTSW 7 98716393 missense probably benign 0.11
R5994:Thap12 UTSW 7 98716030 nonsense probably null
R6298:Thap12 UTSW 7 98703405 missense probably damaging 1.00
R6515:Thap12 UTSW 7 98707095 missense probably damaging 0.97
R6624:Thap12 UTSW 7 98715586 nonsense probably null
R6625:Thap12 UTSW 7 98716070 missense probably benign 0.00
R6965:Thap12 UTSW 7 98715462 missense probably damaging 1.00
R7560:Thap12 UTSW 7 98710231 missense probably damaging 0.99
R8713:Thap12 UTSW 7 98707076 missense probably benign 0.30
R9099:Thap12 UTSW 7 98715393 missense probably damaging 1.00
R9260:Thap12 UTSW 7 98707073 nonsense probably null
R9339:Thap12 UTSW 7 98715116 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCTGGTTCTCATGGGAAAGCAG -3'
(R):5'- AATCTCCGCATCAGCTTCATAC -3'

Sequencing Primer
(F):5'- GTTCTCATGGGAAAGCAGAACATCC -3'
(R):5'- GCATCAGCTTCATACGGCAG -3'
Posted On 2021-08-02