Incidental Mutation 'R8897:Frem3'
ID 678107
Institutional Source Beutler Lab
Gene Symbol Frem3
Ensembl Gene ENSMUSG00000042353
Gene Name Fras1 related extracellular matrix protein 3
Synonyms LOC333315
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock # R8897 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 80611080-80695356 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 80612790 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 571 (I571F)
Ref Sequence ENSEMBL: ENSMUSP00000038015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039695]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000039695
AA Change: I571F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038015
Gene: ENSMUSG00000042353
AA Change: I571F

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cadherin_3 369 515 9.5e-31 PFAM
Pfam:Cadherin_3 495 596 9.4e-20 PFAM
Pfam:Cadherin_3 637 786 4.2e-20 PFAM
Pfam:Cadherin_3 788 913 5.5e-23 PFAM
Pfam:Cadherin_3 998 1163 1.8e-20 PFAM
Pfam:Cadherin_3 1129 1254 1.3e-19 PFAM
Pfam:Cadherin_3 1250 1395 9.5e-34 PFAM
Pfam:Cadherin_3 1397 1508 2.7e-21 PFAM
Pfam:Cadherin_3 1493 1617 1.2e-27 PFAM
Pfam:Cadherin_3 1622 1748 4.8e-17 PFAM
Calx_beta 1754 1853 1.45e-7 SMART
Calx_beta 1866 1977 3.35e-12 SMART
Calx_beta 1991 2098 1.61e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The protein belongs to the family of FRAS1/FREM extracellular matrix proteins and may play a role cell adhesion. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T A 18: 6,635,934 L329Q probably damaging Het
5430419D17Rik T C 7: 131,265,837 M1409T unknown Het
Adam26b A T 8: 43,520,972 M331K possibly damaging Het
Ak3 T C 19: 29,047,718 S38G probably damaging Het
Ankrd10 A T 8: 11,615,788 C271S possibly damaging Het
Ap1s3 A G 1: 79,623,777 Y66H probably damaging Het
Ap4b1 A T 3: 103,821,749 I736L probably benign Het
Arpp19 T A 9: 75,056,666 M67K possibly damaging Het
Brf1 T G 12: 112,987,969 H130P probably damaging Het
Cacna1s C G 1: 136,117,654 T1680S probably benign Het
Cckar C T 5: 53,707,241 probably benign Het
Cd93 T C 2: 148,441,612 K605E probably benign Het
Ces1h C T 8: 93,353,465 V474I unknown Het
Cfap70 A T 14: 20,443,601 probably null Het
Ch25h G A 19: 34,475,041 T29I possibly damaging Het
Csmd3 T A 15: 48,359,343 T329S probably benign Het
Cux1 T C 5: 136,286,769 N1139S probably damaging Het
Cyp2j6 G T 4: 96,525,850 H393N probably benign Het
Cyp8b1 C A 9: 121,916,292 probably benign Het
Dchs2 T G 3: 83,129,413 L489R probably damaging Het
Dip2a T C 10: 76,274,264 T1173A probably benign Het
Exoc3l2 T G 7: 19,470,006 probably null Het
Fastkd3 G A 13: 68,584,184 R208H probably damaging Het
Fbxo16 C A 14: 65,293,838 R64S probably benign Het
Ftsj3 T A 11: 106,253,776 D129V probably damaging Het
Gm6370 A G 5: 146,493,637 T211A probably benign Het
Gpr171 A T 3: 59,097,695 S220T probably benign Het
Gsta3 T C 1: 21,260,146 I124T probably benign Het
Hydin A G 8: 110,589,480 I4335V probably benign Het
Ift80 T C 3: 68,950,476 I279V probably benign Het
Ighv1-13 T A 12: 114,630,819 M47K unknown Het
Il22ra2 A G 10: 19,631,653 N138S probably damaging Het
Impact A G 18: 12,990,494 D298G probably benign Het
Ipo7 T C 7: 110,044,736 probably null Het
Kif5b T C 18: 6,225,437 N198D probably damaging Het
Klhl36 A G 8: 119,870,540 T327A probably benign Het
Lepr A G 4: 101,792,036 N878S probably damaging Het
Lpxn T A 19: 12,825,161 F244L probably damaging Het
Lrriq4 C A 3: 30,655,658 L384I probably damaging Het
Ltbp4 A C 7: 27,326,694 I629S probably benign Het
Lypd5 T C 7: 24,351,590 V42A probably benign Het
Mc4r A G 18: 66,859,233 S270P probably damaging Het
Mctp2 T G 7: 72,259,563 M1L probably benign Het
Myh4 G A 11: 67,246,536 E528K possibly damaging Het
Nes T A 3: 87,979,346 H1637Q possibly damaging Het
Olfr1002 A T 2: 85,647,843 H159Q possibly damaging Het
Olfr1303 T C 2: 111,814,231 D165G probably benign Het
Olfr918 C T 9: 38,672,851 V198I probably damaging Het
Pan3 T C 5: 147,450,662 M147T probably benign Het
Pcdhga6 G T 18: 37,708,589 R454L probably benign Het
Pdss2 A G 10: 43,345,667 S192G probably damaging Het
Pld6 A T 11: 59,787,556 M27K probably benign Het
Plec C T 15: 76,173,398 R4113H probably damaging Het
Ptprk T C 10: 28,591,957 S1379P probably damaging Het
Rapgef2 T C 3: 79,112,259 H35R probably damaging Het
Rasgrp2 A G 19: 6,403,070 T75A probably benign Het
Rexo1 A G 10: 80,542,603 L1172P probably damaging Het
Rfx7 C T 9: 72,617,841 S771L probably benign Het
Rpap3 A G 15: 97,688,117 I331T probably benign Het
Scn2a A G 2: 65,715,658 probably null Het
Sec23ip T A 7: 128,752,743 V241D probably benign Het
Sez6l C A 5: 112,440,878 Q656H possibly damaging Het
Sh3gl2 A T 4: 85,355,360 I50L probably benign Het
Tab2 T C 10: 7,911,133 D605G probably damaging Het
Tas2r110 T A 6: 132,868,411 V135D probably damaging Het
Thap12 T C 7: 98,715,327 M234T probably benign Het
Trhr C A 15: 44,197,340 D85E probably benign Het
Trim67 A G 8: 124,825,979 I607V probably benign Het
Trpm4 C T 7: 45,310,631 C760Y probably benign Het
Ttll9 T C 2: 153,002,921 V403A probably damaging Het
Uhrf1 T C 17: 56,310,817 Y180H probably damaging Het
Unc119b C T 5: 115,134,918 probably benign Het
Vmn2r44 T A 7: 8,378,243 D217V probably damaging Het
Zfp521 C A 18: 13,846,080 L425F probably damaging Het
Zscan4-ps3 A T 7: 11,612,840 R268* probably null Het
Other mutations in Frem3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Frem3 APN 8 80668810 missense possibly damaging 0.75
IGL01019:Frem3 APN 8 80615134 missense probably benign 0.02
IGL01470:Frem3 APN 8 80614315 missense probably damaging 1.00
IGL01609:Frem3 APN 8 80612704 missense probably benign 0.00
IGL01622:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01623:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01751:Frem3 APN 8 80615743 missense probably benign 0.33
IGL02037:Frem3 APN 8 80611489 missense probably benign 0.31
IGL02039:Frem3 APN 8 80612971 missense probably damaging 1.00
IGL02084:Frem3 APN 8 80612443 missense possibly damaging 0.95
IGL02124:Frem3 APN 8 80613094 missense probably damaging 0.99
IGL02140:Frem3 APN 8 80614107 missense possibly damaging 0.84
IGL02836:Frem3 APN 8 80614381 missense probably benign
IGL03090:Frem3 APN 8 80618229 missense probably benign 0.01
IGL03102:Frem3 APN 8 80613032 missense possibly damaging 0.92
IGL03116:Frem3 APN 8 80612806 missense possibly damaging 0.84
IGL03165:Frem3 APN 8 80612529 missense probably benign 0.26
IGL03224:Frem3 APN 8 80613463 missense probably damaging 1.00
IGL03401:Frem3 APN 8 80614541 missense probably damaging 1.00
IGL03403:Frem3 APN 8 80611090 missense probably benign 0.04
FR4340:Frem3 UTSW 8 80615241 small insertion probably benign
FR4976:Frem3 UTSW 8 80615241 small insertion probably benign
IGL02991:Frem3 UTSW 8 80668882 missense probably damaging 1.00
IGL03052:Frem3 UTSW 8 80614530 missense probably damaging 1.00
R0089:Frem3 UTSW 8 80615878 missense possibly damaging 0.94
R0647:Frem3 UTSW 8 80615185 missense probably damaging 1.00
R0690:Frem3 UTSW 8 80613952 missense possibly damaging 0.84
R0766:Frem3 UTSW 8 80615322 missense probably benign
R0834:Frem3 UTSW 8 80687008 missense probably damaging 1.00
R0909:Frem3 UTSW 8 80663406 missense probably benign 0.45
R1033:Frem3 UTSW 8 80695157 missense probably benign 0.00
R1144:Frem3 UTSW 8 80611884 missense probably benign 0.01
R1312:Frem3 UTSW 8 80615322 missense probably benign
R1330:Frem3 UTSW 8 80668839 missense probably damaging 0.99
R1355:Frem3 UTSW 8 80690702 missense probably damaging 1.00
R1390:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R1413:Frem3 UTSW 8 80668801 missense probably benign
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1503:Frem3 UTSW 8 80687018 missense probably damaging 0.99
R1538:Frem3 UTSW 8 80612710 missense probably damaging 1.00
R1538:Frem3 UTSW 8 80613135 missense probably benign 0.00
R1612:Frem3 UTSW 8 80614861 missense probably damaging 1.00
R1793:Frem3 UTSW 8 80613112 missense probably benign 0.03
R1872:Frem3 UTSW 8 80612576 missense probably damaging 1.00
R1879:Frem3 UTSW 8 80611938 nonsense probably null
R1886:Frem3 UTSW 8 80613885 missense probably benign 0.00
R1933:Frem3 UTSW 8 80612890 missense probably benign 0.00
R2027:Frem3 UTSW 8 80695337 missense possibly damaging 0.75
R2040:Frem3 UTSW 8 80615826 missense possibly damaging 0.92
R2050:Frem3 UTSW 8 80614891 missense probably damaging 1.00
R2079:Frem3 UTSW 8 80615103 missense probably benign 0.03
R2099:Frem3 UTSW 8 80615859 missense probably benign 0.06
R2120:Frem3 UTSW 8 80615457 missense probably benign 0.20
R2842:Frem3 UTSW 8 80669349 splice site probably null
R2845:Frem3 UTSW 8 80613220 missense probably damaging 1.00
R3015:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R3442:Frem3 UTSW 8 80613040 missense probably damaging 1.00
R3724:Frem3 UTSW 8 80615271 missense probably benign 0.06
R3730:Frem3 UTSW 8 80615916 missense probably damaging 0.99
R3939:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3940:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3941:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R4089:Frem3 UTSW 8 80615173 missense probably damaging 1.00
R4282:Frem3 UTSW 8 80614141 missense probably benign 0.00
R4437:Frem3 UTSW 8 80612607 missense probably benign 0.30
R4480:Frem3 UTSW 8 80611357 missense probably benign 0.10
R4575:Frem3 UTSW 8 80616075 missense probably benign 0.17
R4583:Frem3 UTSW 8 80613514 missense probably benign 0.03
R4620:Frem3 UTSW 8 80668957 missense possibly damaging 0.82
R4621:Frem3 UTSW 8 80669191 splice site probably null
R4644:Frem3 UTSW 8 80613727 missense probably benign 0.33
R4667:Frem3 UTSW 8 80663420 missense probably damaging 0.97
R4748:Frem3 UTSW 8 80611459 missense probably damaging 1.00
R4823:Frem3 UTSW 8 80613958 missense probably benign 0.25
R4836:Frem3 UTSW 8 80663397 missense probably damaging 0.99
R4867:Frem3 UTSW 8 80613283 missense probably damaging 1.00
R4921:Frem3 UTSW 8 80613136 missense possibly damaging 0.83
R5030:Frem3 UTSW 8 80613247 missense possibly damaging 0.89
R5035:Frem3 UTSW 8 80615914 missense probably damaging 0.97
R5172:Frem3 UTSW 8 80612566 missense probably benign 0.44
R5289:Frem3 UTSW 8 80612319 missense probably benign 0.00
R5492:Frem3 UTSW 8 80612677 missense probably damaging 1.00
R5655:Frem3 UTSW 8 80612694 missense probably benign 0.00
R5685:Frem3 UTSW 8 80695303 missense probably damaging 1.00
R5723:Frem3 UTSW 8 80613397 missense probably benign 0.02
R5743:Frem3 UTSW 8 80615778 missense probably damaging 0.98
R5889:Frem3 UTSW 8 80614288 missense probably damaging 1.00
R6048:Frem3 UTSW 8 80613433 missense probably benign 0.03
R6057:Frem3 UTSW 8 80615587 missense probably damaging 0.99
R6137:Frem3 UTSW 8 80615047 missense probably benign
R6264:Frem3 UTSW 8 80615203 missense probably damaging 1.00
R6339:Frem3 UTSW 8 80613015 missense possibly damaging 0.84
R6418:Frem3 UTSW 8 80611152 missense probably benign 0.08
R6680:Frem3 UTSW 8 80669320 missense probably damaging 1.00
R6773:Frem3 UTSW 8 80611815 missense probably damaging 1.00
R6838:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R6928:Frem3 UTSW 8 80611282 missense possibly damaging 0.48
R6939:Frem3 UTSW 8 80615145 missense probably benign 0.23
R6995:Frem3 UTSW 8 80612579 missense probably damaging 0.98
R7112:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7155:Frem3 UTSW 8 80616039 missense probably benign 0.01
R7235:Frem3 UTSW 8 80690725 missense probably benign 0.00
R7282:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7403:Frem3 UTSW 8 80616145 missense probably damaging 1.00
R7422:Frem3 UTSW 8 80615763 missense probably benign 0.00
R7485:Frem3 UTSW 8 80613336 missense probably damaging 1.00
R7516:Frem3 UTSW 8 80612083 missense probably damaging 0.99
R7858:Frem3 UTSW 8 80611721 nonsense probably null
R7976:Frem3 UTSW 8 80611602 nonsense probably null
R8171:Frem3 UTSW 8 80615240 missense probably damaging 1.00
R8185:Frem3 UTSW 8 80612304 nonsense probably null
R8306:Frem3 UTSW 8 80612211 missense possibly damaging 0.95
R8478:Frem3 UTSW 8 80611558 missense probably damaging 1.00
R8518:Frem3 UTSW 8 80612595 missense probably damaging 1.00
R8794:Frem3 UTSW 8 80612278 missense probably damaging 1.00
R8794:Frem3 UTSW 8 80616222 missense probably benign 0.02
R8806:Frem3 UTSW 8 80663435 missense probably benign 0.30
R8833:Frem3 UTSW 8 80612772 missense probably benign 0.29
R8879:Frem3 UTSW 8 80613148 missense probably damaging 0.98
R8983:Frem3 UTSW 8 80669246 missense probably damaging 1.00
R9207:Frem3 UTSW 8 80613442 missense possibly damaging 0.73
R9277:Frem3 UTSW 8 80690773 missense probably damaging 0.96
RF030:Frem3 UTSW 8 80615238 small insertion probably benign
RF034:Frem3 UTSW 8 80615238 small insertion probably benign
RF042:Frem3 UTSW 8 80615238 small insertion probably benign
X0024:Frem3 UTSW 8 80613081 missense possibly damaging 0.76
X0027:Frem3 UTSW 8 80612388 nonsense probably null
Z1088:Frem3 UTSW 8 80615426 missense probably benign 0.04
Z1176:Frem3 UTSW 8 80611503 missense probably damaging 0.99
Z1176:Frem3 UTSW 8 80615431 missense probably benign 0.03
Z1177:Frem3 UTSW 8 80616129 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGGCAGTGACTCTTACAGTG -3'
(R):5'- CTACCGTCTCATAAAGGCCCTC -3'

Sequencing Primer
(F):5'- GTGACTCTTACAGTGACAACATC -3'
(R):5'- AGGCCCTCCTTTTCCACATAGTG -3'
Posted On 2021-08-02