Incidental Mutation 'R8897:Ptprk'
ID678118
Institutional Source Beutler Lab
Gene Symbol Ptprk
Ensembl Gene ENSMUSG00000019889
Gene Nameprotein tyrosine phosphatase, receptor type, K
SynonymsRPTPkappa, PTPk
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8897 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location28074820-28597397 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28591957 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1379 (S1379P)
Ref Sequence ENSEMBL: ENSMUSP00000151866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166468] [ENSMUST00000218276] [ENSMUST00000218359] [ENSMUST00000220357]
AlphaFold P35822
Predicted Effect probably damaging
Transcript: ENSMUST00000166468
AA Change: S1365P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126279
Gene: ENSMUSG00000019889
AA Change: S1365P

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
MAM 30 193 1.61e-73 SMART
IG 200 288 2.16e-8 SMART
FN3 290 373 1.48e-4 SMART
FN3 389 475 4.24e1 SMART
FN3 491 579 3.32e-7 SMART
transmembrane domain 753 774 N/A INTRINSIC
PTPc 898 1161 3.56e-132 SMART
PTPc 1190 1455 2.68e-86 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000218276
AA Change: S1379P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000218359
AA Change: S1353P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000220357
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP mu (MAM) domain, an Ig-like domain and four fibronectin type III-like repeats. This PTP was shown to mediate homophilic intercellular interaction, possibly through the interaction with beta- and gamma-catenin at adherens junctions. Expression of this gene was found to be stimulated by TGF-beta 1, which may be important for the inhibition of keratinocyte proliferation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T A 18: 6,635,934 L329Q probably damaging Het
5430419D17Rik T C 7: 131,265,837 M1409T unknown Het
Adam26b A T 8: 43,520,972 M331K possibly damaging Het
Ak3 T C 19: 29,047,718 S38G probably damaging Het
Ankrd10 A T 8: 11,615,788 C271S possibly damaging Het
Ap1s3 A G 1: 79,623,777 Y66H probably damaging Het
Ap4b1 A T 3: 103,821,749 I736L probably benign Het
Arpp19 T A 9: 75,056,666 M67K possibly damaging Het
Brf1 T G 12: 112,987,969 H130P probably damaging Het
Cacna1s C G 1: 136,117,654 T1680S probably benign Het
Cckar C T 5: 53,707,241 probably benign Het
Cd93 T C 2: 148,441,612 K605E probably benign Het
Ces1h C T 8: 93,353,465 V474I unknown Het
Cfap70 A T 14: 20,443,601 probably null Het
Ch25h G A 19: 34,475,041 T29I possibly damaging Het
Csmd3 T A 15: 48,359,343 T329S probably benign Het
Cux1 T C 5: 136,286,769 N1139S probably damaging Het
Cyp2j6 G T 4: 96,525,850 H393N probably benign Het
Cyp8b1 C A 9: 121,916,292 probably benign Het
Dchs2 T G 3: 83,129,413 L489R probably damaging Het
Dip2a T C 10: 76,274,264 T1173A probably benign Het
Exoc3l2 T G 7: 19,470,006 probably null Het
Fastkd3 G A 13: 68,584,184 R208H probably damaging Het
Fbxo16 C A 14: 65,293,838 R64S probably benign Het
Frem3 A T 8: 80,612,790 I571F probably damaging Het
Ftsj3 T A 11: 106,253,776 D129V probably damaging Het
Gm6370 A G 5: 146,493,637 T211A probably benign Het
Gpr171 A T 3: 59,097,695 S220T probably benign Het
Gsta3 T C 1: 21,260,146 I124T probably benign Het
Hydin A G 8: 110,589,480 I4335V probably benign Het
Ift80 T C 3: 68,950,476 I279V probably benign Het
Ighv1-13 T A 12: 114,630,819 M47K unknown Het
Il22ra2 A G 10: 19,631,653 N138S probably damaging Het
Impact A G 18: 12,990,494 D298G probably benign Het
Ipo7 T C 7: 110,044,736 probably null Het
Kif5b T C 18: 6,225,437 N198D probably damaging Het
Klhl36 A G 8: 119,870,540 T327A probably benign Het
Lepr A G 4: 101,792,036 N878S probably damaging Het
Lpxn T A 19: 12,825,161 F244L probably damaging Het
Lrriq4 C A 3: 30,655,658 L384I probably damaging Het
Ltbp4 A C 7: 27,326,694 I629S probably benign Het
Lypd5 T C 7: 24,351,590 V42A probably benign Het
Mc4r A G 18: 66,859,233 S270P probably damaging Het
Mctp2 T G 7: 72,259,563 M1L probably benign Het
Myh4 G A 11: 67,246,536 E528K possibly damaging Het
Nes T A 3: 87,979,346 H1637Q possibly damaging Het
Olfr1002 A T 2: 85,647,843 H159Q possibly damaging Het
Olfr1303 T C 2: 111,814,231 D165G probably benign Het
Olfr918 C T 9: 38,672,851 V198I probably damaging Het
Pan3 T C 5: 147,450,662 M147T probably benign Het
Pcdhga6 G T 18: 37,708,589 R454L probably benign Het
Pdss2 A G 10: 43,345,667 S192G probably damaging Het
Pld6 A T 11: 59,787,556 M27K probably benign Het
Plec C T 15: 76,173,398 R4113H probably damaging Het
Rapgef2 T C 3: 79,112,259 H35R probably damaging Het
Rasgrp2 A G 19: 6,403,070 T75A probably benign Het
Rexo1 A G 10: 80,542,603 L1172P probably damaging Het
Rfx7 C T 9: 72,617,841 S771L probably benign Het
Rpap3 A G 15: 97,688,117 I331T probably benign Het
Scn2a A G 2: 65,715,658 probably null Het
Sec23ip T A 7: 128,752,743 V241D probably benign Het
Sez6l C A 5: 112,440,878 Q656H possibly damaging Het
Sh3gl2 A T 4: 85,355,360 I50L probably benign Het
Tab2 T C 10: 7,911,133 D605G probably damaging Het
Tas2r110 T A 6: 132,868,411 V135D probably damaging Het
Thap12 T C 7: 98,715,327 M234T probably benign Het
Trhr C A 15: 44,197,340 D85E probably benign Het
Trim67 A G 8: 124,825,979 I607V probably benign Het
Trpm4 C T 7: 45,310,631 C760Y probably benign Het
Ttll9 T C 2: 153,002,921 V403A probably damaging Het
Uhrf1 T C 17: 56,310,817 Y180H probably damaging Het
Unc119b C T 5: 115,134,918 probably benign Het
Vmn2r44 T A 7: 8,378,243 D217V probably damaging Het
Zfp521 C A 18: 13,846,080 L425F probably damaging Het
Zscan4-ps3 A T 7: 11,612,840 R268* probably null Het
Other mutations in Ptprk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Ptprk APN 10 28336510 missense possibly damaging 0.92
IGL00533:Ptprk APN 10 28585975 missense probably damaging 0.97
IGL01062:Ptprk APN 10 28580418 missense probably damaging 1.00
IGL01295:Ptprk APN 10 28475178 missense probably benign 0.14
IGL01372:Ptprk APN 10 28569927 missense probably benign 0.00
IGL01452:Ptprk APN 10 28574917 critical splice donor site probably null
IGL01829:Ptprk APN 10 28573387 missense probably damaging 1.00
IGL01861:Ptprk APN 10 28383445 missense possibly damaging 0.80
IGL01955:Ptprk APN 10 28595865 unclassified probably benign
IGL02263:Ptprk APN 10 28075114 missense unknown
IGL02489:Ptprk APN 10 28383472 missense probably damaging 1.00
IGL02697:Ptprk APN 10 28575618 missense possibly damaging 0.85
IGL02713:Ptprk APN 10 28592811 missense possibly damaging 0.92
IGL02943:Ptprk APN 10 28475176 missense possibly damaging 0.81
IGL03240:Ptprk APN 10 28492961 missense probably damaging 0.99
IGL03373:Ptprk APN 10 28566537 missense probably damaging 1.00
LCD18:Ptprk UTSW 10 28574987 intron probably benign
PIT4366001:Ptprk UTSW 10 28586019 missense probably benign
R0010:Ptprk UTSW 10 28585969 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0021:Ptprk UTSW 10 28592895 missense probably damaging 1.00
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0035:Ptprk UTSW 10 28263508 nonsense probably null
R0053:Ptprk UTSW 10 28475109 missense probably damaging 0.99
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0063:Ptprk UTSW 10 28263767 missense probably damaging 1.00
R0244:Ptprk UTSW 10 28206225 missense possibly damaging 0.79
R0281:Ptprk UTSW 10 28573392 missense probably damaging 1.00
R0387:Ptprk UTSW 10 28354629 missense possibly damaging 0.66
R0480:Ptprk UTSW 10 28585947 missense probably damaging 1.00
R0480:Ptprk UTSW 10 28585948 missense probably damaging 1.00
R0585:Ptprk UTSW 10 28575668 missense probably damaging 1.00
R0614:Ptprk UTSW 10 28075136 missense probably damaging 0.96
R0684:Ptprk UTSW 10 28483298 splice site probably benign
R1073:Ptprk UTSW 10 28496947 critical splice donor site probably null
R1377:Ptprk UTSW 10 28586026 missense probably benign 0.42
R1422:Ptprk UTSW 10 28475280 missense possibly damaging 0.64
R1482:Ptprk UTSW 10 28263516 missense probably benign 0.24
R1532:Ptprk UTSW 10 28585630 missense probably damaging 1.00
R1576:Ptprk UTSW 10 28551651 missense probably damaging 1.00
R1618:Ptprk UTSW 10 28493170 missense probably benign 0.00
R1654:Ptprk UTSW 10 28383647 missense probably damaging 1.00
R1701:Ptprk UTSW 10 28466058 missense probably damaging 1.00
R1747:Ptprk UTSW 10 28354692 missense possibly damaging 0.78
R2033:Ptprk UTSW 10 28592767 unclassified probably benign
R2059:Ptprk UTSW 10 28566603 missense probably damaging 1.00
R2076:Ptprk UTSW 10 28589368 missense probably damaging 0.98
R2164:Ptprk UTSW 10 28560142 missense probably damaging 1.00
R2260:Ptprk UTSW 10 28206149 missense possibly damaging 0.65
R2394:Ptprk UTSW 10 28551717 missense probably damaging 0.98
R2432:Ptprk UTSW 10 28592844 missense probably damaging 1.00
R2437:Ptprk UTSW 10 28354713 missense probably damaging 1.00
R2495:Ptprk UTSW 10 28475078 splice site probably benign
R3037:Ptprk UTSW 10 28580478 missense probably damaging 1.00
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3162:Ptprk UTSW 10 28592826 missense probably benign
R3687:Ptprk UTSW 10 28473043 missense probably damaging 1.00
R3722:Ptprk UTSW 10 28383623 missense probably damaging 1.00
R3892:Ptprk UTSW 10 28263621 missense probably benign 0.02
R3963:Ptprk UTSW 10 28551665 missense probably damaging 0.99
R4077:Ptprk UTSW 10 28263512 missense probably benign
R4079:Ptprk UTSW 10 28263512 missense probably benign
R4112:Ptprk UTSW 10 28475288 critical splice donor site probably null
R4255:Ptprk UTSW 10 28206245 missense probably benign 0.14
R4523:Ptprk UTSW 10 28466052 missense probably damaging 0.99
R4651:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4652:Ptprk UTSW 10 28263690 missense probably damaging 0.99
R4828:Ptprk UTSW 10 28560054 missense probably damaging 1.00
R4829:Ptprk UTSW 10 28580484 nonsense probably null
R4883:Ptprk UTSW 10 28588932 missense probably damaging 1.00
R5004:Ptprk UTSW 10 28586063 missense possibly damaging 0.95
R5013:Ptprk UTSW 10 28551717 missense probably damaging 0.99
R5092:Ptprk UTSW 10 28592773 missense probably damaging 1.00
R5126:Ptprk UTSW 10 28575644 splice site probably null
R5183:Ptprk UTSW 10 28475236 missense probably benign 0.02
R5264:Ptprk UTSW 10 28585586 missense probably damaging 1.00
R5304:Ptprk UTSW 10 28592054 splice site probably null
R5330:Ptprk UTSW 10 28587080 missense probably damaging 1.00
R5474:Ptprk UTSW 10 28496930 nonsense probably null
R5516:Ptprk UTSW 10 28496930 nonsense probably null
R5796:Ptprk UTSW 10 28383575 missense probably damaging 1.00
R5843:Ptprk UTSW 10 28493064 missense probably damaging 0.99
R5952:Ptprk UTSW 10 28585675 missense probably damaging 0.99
R6065:Ptprk UTSW 10 28475170 missense probably damaging 1.00
R6226:Ptprk UTSW 10 28564103 missense probably benign 0.02
R6264:Ptprk UTSW 10 28566673 missense probably damaging 1.00
R6638:Ptprk UTSW 10 28595811 missense probably damaging 1.00
R6843:Ptprk UTSW 10 28591982 missense possibly damaging 0.86
R6860:Ptprk UTSW 10 28334484 missense probably damaging 1.00
R6869:Ptprk UTSW 10 28473059 critical splice donor site probably null
R7214:Ptprk UTSW 10 28574909 missense probably benign 0.11
R7307:Ptprk UTSW 10 28589008 nonsense probably null
R7349:Ptprk UTSW 10 28592838 missense possibly damaging 0.85
R7442:Ptprk UTSW 10 28574819 missense probably damaging 1.00
R7585:Ptprk UTSW 10 28560088 missense probably damaging 1.00
R7661:Ptprk UTSW 10 28466040 missense probably benign 0.00
R7694:Ptprk UTSW 10 28589370 missense possibly damaging 0.63
R7740:Ptprk UTSW 10 28496924 missense probably damaging 1.00
R7810:Ptprk UTSW 10 28592857 missense probably damaging 0.97
R7831:Ptprk UTSW 10 28568408 missense possibly damaging 0.89
R7836:Ptprk UTSW 10 28573389 missense probably damaging 1.00
R8049:Ptprk UTSW 10 28383569 missense possibly damaging 0.84
R8235:Ptprk UTSW 10 28589041 missense possibly damaging 0.70
R8274:Ptprk UTSW 10 28580412 missense probably damaging 1.00
R8286:Ptprk UTSW 10 28568327 missense probably damaging 1.00
R8372:Ptprk UTSW 10 28354692 missense possibly damaging 0.78
R8727:Ptprk UTSW 10 28566545 unclassified probably benign
R8794:Ptprk UTSW 10 28263508 nonsense probably null
R8842:Ptprk UTSW 10 28566501 missense probably damaging 0.97
R8861:Ptprk UTSW 10 28570190 missense probably damaging 1.00
R8910:Ptprk UTSW 10 28492997 missense possibly damaging 0.68
R8919:Ptprk UTSW 10 28483207 nonsense probably null
R8976:Ptprk UTSW 10 28585673 missense probably damaging 1.00
R8982:Ptprk UTSW 10 28560142 missense probably damaging 1.00
R9036:Ptprk UTSW 10 28585932 missense probably benign 0.01
Z1177:Ptprk UTSW 10 28493120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAAGTTGTGGGTTCTTGC -3'
(R):5'- GGCTAGCCAGGAAATGAGTTC -3'

Sequencing Primer
(F):5'- TAGACTCAGTCCAGTATAAGTTCCC -3'
(R):5'- AAATGAGTTCTGAGGCTCCC -3'
Posted On2021-08-02