Mutagenetix > Incidental Mutation

Incidental Mutation 'R8898:Itga8'

678146

Institutional Source

Beutler Lab

Gene Symbol

Itga8

Ensembl Gene

ENSMUSG00000026768

Gene Name

integrin alpha 8

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.892) question?

Stock #

R8898 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

12106632-12301922 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 12140395 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 916 (S916G)

Ref Sequence

ENSEMBL: ENSMUSP00000028106 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028106] [ENSMUST00000172791]

AlphaFold

A2ARA8

Predicted Effect

probably benign
Transcript: ENSMUST00000028106
AA Change: S916G

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000028106
Gene: ENSMUSG00000026768
AA Change: S916G

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART
SCOP:d1m1xa2	643	780	2e-46	SMART
SCOP:d1m1xa3	784	1000	2e-80	SMART
transmembrane domain	1011	1033	N/A	INTRINSIC
Pfam:Integrin_alpha	1034	1048	2.5e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172791

SMART Domains

Protein: ENSMUSP00000134154
Gene: ENSMUSG00000026768

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Int_alpha	52	112	8.48e-8	SMART
Int_alpha	197	244	4.8e1	SMART
Int_alpha	262	312	5.91e-7	SMART
Int_alpha	316	377	6.94e-13	SMART
Int_alpha	381	437	1.92e-15	SMART
Int_alpha	445	494	8.23e-6	SMART

Meta Mutation Damage Score

0.0626

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: This gene encodes a member of the integrin family of cell surface proteins that mediate cellular interactions with the extracellular matrix and other cells. The encoded protein undergoes proteolytic processing to generate the disulfide-linked heterodimeric alpha subunit which, in turn associates with a beta subunit to form the functional integrin receptor. Mice lacking the encoded protein mostly die after birth due to kidney defects, but some of animals that survive exhibit defects in the sensory hair cells of the inner ear. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die by the end of the second day after birth. Those that do survive have reduced kidneys and abnormal steriocilia in the inner ear. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	T	14: 32,661,044	L988*	probably null	Het
4930546C10Rik	A	G	18: 68,950,035	F36S	unknown	Het
Acan	C	A	7: 79,100,353	T1624K	possibly damaging	Het
Ambn	T	C	5: 88,465,192		probably null	Het
Ankrd24	T	C	10: 81,642,518	I437T	unknown	Het
Arl4d	C	T	11: 101,667,001	R118W	probably damaging	Het
Atg2a	A	G	19: 6,256,691		probably benign	Het
Bcan	T	C	3: 87,988,388	T814A	probably benign	Het
Brca2	T	A	5: 150,569,033	M3171K	possibly damaging	Het
Cd209a	T	A	8: 3,748,739	S23C	probably damaging	Het
Chek2	A	T	5: 110,863,309	K324N	probably benign	Het
Col12a1	C	T	9: 79,692,295	V859I	probably benign	Het
Cyp7b1	C	T	3: 18,096,624	R317H	probably benign	Het
Dmxl2	A	G	9: 54,401,657	S1937P	probably benign	Het
Epb41l1	T	G	2: 156,493,949	V11G	probably damaging	Het
Ephb6	C	T	6: 41,613,359	A15V	probably benign	Het
Fat3	G	A	9: 15,947,526	P3798L	probably benign	Het
Foxd1	T	A	13: 98,355,088	C157S	probably damaging	Het
Gja10	T	C	4: 32,601,058	Q442R	probably benign	Het
Gm17019	A	C	5: 15,031,784	M47R	possibly damaging	Het
Gpr179	C	A	11: 97,351,503	E172*	probably null	Het
Grhl1	G	A	12: 24,584,946		probably null	Het
Gtf2ird2	A	T	5: 134,197,265	E184V	probably benign	Het
Hace1	A	G	10: 45,700,670	I813V	probably benign	Het
Hk2	A	T	6: 82,738,398	L385Q	probably damaging	Het
Htt	C	T	5: 34,819,032	T726I	probably benign	Het
Jag1	A	T	2: 137,093,255	F396I	probably damaging	Het
Kif16b	A	G	2: 142,712,979	M633T	possibly damaging	Het
Klf5	T	A	14: 99,301,486	F112I	probably damaging	Het
Lama1	A	T	17: 67,821,615	Q2989L		Het
Lrrc28	C	A	7: 67,628,294		probably null	Het
Map4k5	T	C	12: 69,813,157	T739A	possibly damaging	Het
Mbd3l2	A	T	9: 18,444,618	R80*	probably null	Het
Mctp2	T	C	7: 72,103,156	E783G	probably damaging	Het
Mill2	A	T	7: 18,856,564	M190L	probably benign	Het
N4bp3	T	C	11: 51,644,429	N311S	probably benign	Het
Nanos2	A	T	7: 18,987,624	D7V	probably damaging	Het
Ndufs7	T	A	10: 80,253,785		probably null	Het
Nexn	T	C	3: 152,242,669	N483S	probably benign	Het
Nlrp1b	T	G	11: 71,182,462	E185A	probably damaging	Het
Nop2	C	A	6: 125,137,155	Q195K	probably benign	Het
Olfr1234	A	G	2: 89,362,613	V272A	possibly damaging	Het
Olfr732	G	A	14: 50,281,495	P253S	probably damaging	Het
Pde12	G	A	14: 26,669,422	S44L	probably benign	Het
Pde1c	A	T	6: 56,137,386	V514E	probably damaging	Het
Pdzph1	A	T	17: 58,974,339	V316D	probably benign	Het
Prl3c1	A	T	13: 27,203,595	I208F	possibly damaging	Het
Raver2	G	A	4: 101,107,202		probably null	Het
Rpl13a-ps1	T	A	19: 50,030,308	H143L	probably benign	Het
Sept14	A	T	5: 129,683,578	I402K	possibly damaging	Het
Sla2	T	A	2: 156,875,965	Y129F	possibly damaging	Het
Smarca2	TGCAGCAGCAGCAGCAGCA	TGCAGCAGCAGCAGCA	19: 26,630,958		probably benign	Het
Sorl1	A	G	9: 42,000,271	S1448P	probably damaging	Het
Spast	G	A	17: 74,388,278	R604H	probably damaging	Het
Speg	G	A	1: 75,388,873	G633S	probably damaging	Het
Stxbp5l	ATTTT	ATTTTT	16: 37,216,052		probably null	Het
Syt11	T	C	3: 88,762,028	M186V	probably benign	Het
Tex26	C	A	5: 149,456,904	N133K	probably benign	Het
Tnfrsf17	T	C	16: 11,314,046	C32R	probably damaging	Het
Trem1	T	A	17: 48,237,346	V133E	probably damaging	Het
Trpm7	A	T	2: 126,822,741	M906K	possibly damaging	Het
Ugt2b35	T	A	5: 87,011,330	I461K	possibly damaging	Het
Vmn2r77	T	A	7: 86,795,222	C28S	probably damaging	Het
Zfp521	C	A	18: 13,846,080	L425F	probably damaging	Het
Zfp790	C	T	7: 29,823,100		probably benign	Het

Other mutations in Itga8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00806:Itga8	APN	2	12255966	nonsense	probably null
IGL00820:Itga8	APN	2	12232892	missense	possibly damaging	0.85
IGL01409:Itga8	APN	2	12191714	missense	probably benign
IGL01508:Itga8	APN	2	12232802	missense	possibly damaging	0.67
IGL01585:Itga8	APN	2	12160312	splice site	probably benign
IGL01590:Itga8	APN	2	12160333	missense	probably damaging	1.00
IGL01743:Itga8	APN	2	12265333	missense	probably benign	0.04
IGL02634:Itga8	APN	2	12140478	missense	possibly damaging	0.55
IGL02805:Itga8	APN	2	12189480	missense	possibly damaging	0.83
IGL03200:Itga8	APN	2	12191199	missense	probably benign	0.00
IGL03218:Itga8	APN	2	12111025	missense	possibly damaging	0.77
IGL03248:Itga8	APN	2	12132516	missense	probably benign	0.20
PIT4576001:Itga8	UTSW	2	12230092	missense	probably benign	0.19
R0196:Itga8	UTSW	2	12204729	critical splice donor site	probably null
R0356:Itga8	UTSW	2	12182721	missense	possibly damaging	0.73
R0466:Itga8	UTSW	2	12232886	missense	probably damaging	1.00
R0530:Itga8	UTSW	2	12191816	missense	probably damaging	0.99
R0715:Itga8	UTSW	2	12191242	splice site	probably benign
R0800:Itga8	UTSW	2	12193551	missense	possibly damaging	0.95
R0881:Itga8	UTSW	2	12262192	splice site	probably null
R1675:Itga8	UTSW	2	12200163	missense	probably damaging	0.99
R1758:Itga8	UTSW	2	12265333	missense	possibly damaging	0.83
R1939:Itga8	UTSW	2	12300846	missense	probably damaging	1.00
R2187:Itga8	UTSW	2	12194420	missense	possibly damaging	0.60
R2295:Itga8	UTSW	2	12182709	missense	probably benign	0.38
R2356:Itga8	UTSW	2	12200141	missense	probably benign
R2371:Itga8	UTSW	2	12253466	missense	probably damaging	1.00
R2412:Itga8	UTSW	2	12301715	missense	probably benign
R2440:Itga8	UTSW	2	12178680	missense	possibly damaging	0.70
R2848:Itga8	UTSW	2	12160404	missense	probably damaging	0.98
R3730:Itga8	UTSW	2	12193510	missense	possibly damaging	0.92
R3933:Itga8	UTSW	2	12189519	missense	probably benign
R3982:Itga8	UTSW	2	12300963	missense	possibly damaging	0.92
R4513:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4514:Itga8	UTSW	2	12182736	missense	probably benign	0.01
R4660:Itga8	UTSW	2	12265258	missense	probably damaging	1.00
R4890:Itga8	UTSW	2	12193291	splice site	probably benign
R5533:Itga8	UTSW	2	12160350	missense	possibly damaging	0.90
R5619:Itga8	UTSW	2	12265328	missense	probably damaging	1.00
R5720:Itga8	UTSW	2	12111087	missense	probably damaging	0.99
R5749:Itga8	UTSW	2	12262078	missense	probably damaging	1.00
R5930:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R5954:Itga8	UTSW	2	12132486	missense	probably damaging	0.99
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6035:Itga8	UTSW	2	12191714	missense	probably benign
R6211:Itga8	UTSW	2	12193509	missense	probably damaging	1.00
R6337:Itga8	UTSW	2	12253469	nonsense	probably null
R6442:Itga8	UTSW	2	12230143	missense	probably benign	0.00
R6491:Itga8	UTSW	2	12204776	missense	probably damaging	1.00
R6543:Itga8	UTSW	2	12301644	missense	probably damaging	0.99
R6574:Itga8	UTSW	2	12230161	missense	probably benign	0.17
R6760:Itga8	UTSW	2	12301640	missense	probably damaging	1.00
R6858:Itga8	UTSW	2	12200081	missense	probably benign	0.00
R6943:Itga8	UTSW	2	12155371	critical splice donor site	probably null
R7048:Itga8	UTSW	2	12111084	missense	probably damaging	0.99
R7203:Itga8	UTSW	2	12230095	missense	possibly damaging	0.77
R7266:Itga8	UTSW	2	12232901	missense	probably damaging	1.00
R7323:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R7540:Itga8	UTSW	2	12111037	missense	possibly damaging	0.82
R7637:Itga8	UTSW	2	12109187	missense	probably damaging	1.00
R7748:Itga8	UTSW	2	12230239	missense	possibly damaging	0.80
R7848:Itga8	UTSW	2	12191737	missense	probably damaging	0.99
R8031:Itga8	UTSW	2	12155486	missense	probably benign
R8077:Itga8	UTSW	2	12242433	missense	probably benign	0.09
R8757:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8759:Itga8	UTSW	2	12262129	missense	probably damaging	1.00
R8772:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8773:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8774-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8775-TAIL:Itga8	UTSW	2	12182684	missense	probably damaging	1.00
R8808:Itga8	UTSW	2	12132517	nonsense	probably null
R8962:Itga8	UTSW	2	12191234	missense	possibly damaging	0.94
R9056:Itga8	UTSW	2	12230208	missense	possibly damaging	0.84
R9155:Itga8	UTSW	2	12189519	missense	probably benign
R9354:Itga8	UTSW	2	12232857	missense	possibly damaging	0.94
R9563:Itga8	UTSW	2	12160408	missense	possibly damaging	0.83
R9589:Itga8	UTSW	2	12232890	missense	probably damaging	1.00
R9663:Itga8	UTSW	2	12191769	missense	probably benign	0.00
Z1176:Itga8	UTSW	2	12247518	missense	probably damaging	1.00
Z1176:Itga8	UTSW	2	12262136	missense	probably benign	0.01
Z1176:Itga8	UTSW	2	12301832	start gained	probably benign
Z1177:Itga8	UTSW	2	12300933	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- TGACTTGCCACAATCCATACTG -3'
(R):5'- CCAACCTTTGTGAGCTCTCAGG -3'

Sequencing Primer
(F):5'- TGCTCCAAGCTGTCAGGTG -3'
(R):5'- GAGCTCTCAGGTGAATCCAGTTC -3'

Posted On

2021-08-02