Incidental Mutation 'R8898:Ambn'
ID 678162
Institutional Source Beutler Lab
Gene Symbol Ambn
Ensembl Gene ENSMUSG00000029288
Gene Name ameloblastin
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock # R8898 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 88455991-88468531 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 88465192 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031226] [ENSMUST00000198265]
AlphaFold O55189
Predicted Effect probably benign
Transcript: ENSMUST00000031226
SMART Domains Protein: ENSMUSP00000031226
Gene: ENSMUSG00000029288

DomainStartEndE-ValueType
Amelin 11 407 7.19e-250 SMART
Predicted Effect probably null
Transcript: ENSMUST00000198265
SMART Domains Protein: ENSMUSP00000142944
Gene: ENSMUSG00000029288

DomainStartEndE-ValueType
Amelin 11 422 8.22e-268 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: This gene encodes an extracellular matrix glycoprotein that is involved in the formation of dental enamel. Mice lacking the encoded protein fail to undergo normal ameloblast differentiation and develop enamel. Mice overproducing the product of this gene develop thinner and more porous enamel, with disrupted rod patterns and abnormal crystallites. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice lack enamel and display abnormal ameloblast and tooth morphology and an increased incidence of dental epithelium derived tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,661,044 L988* probably null Het
4930546C10Rik A G 18: 68,950,035 F36S unknown Het
Acan C A 7: 79,100,353 T1624K possibly damaging Het
Ankrd24 T C 10: 81,642,518 I437T unknown Het
Arl4d C T 11: 101,667,001 R118W probably damaging Het
Atg2a A G 19: 6,256,691 probably benign Het
Bcan T C 3: 87,988,388 T814A probably benign Het
Brca2 T A 5: 150,569,033 M3171K possibly damaging Het
Cd209a T A 8: 3,748,739 S23C probably damaging Het
Chek2 A T 5: 110,863,309 K324N probably benign Het
Col12a1 C T 9: 79,692,295 V859I probably benign Het
Cyp7b1 C T 3: 18,096,624 R317H probably benign Het
Dmxl2 A G 9: 54,401,657 S1937P probably benign Het
Epb41l1 T G 2: 156,493,949 V11G probably damaging Het
Ephb6 C T 6: 41,613,359 A15V probably benign Het
Fat3 G A 9: 15,947,526 P3798L probably benign Het
Foxd1 T A 13: 98,355,088 C157S probably damaging Het
Gja10 T C 4: 32,601,058 Q442R probably benign Het
Gm17019 A C 5: 15,031,784 M47R possibly damaging Het
Gpr179 C A 11: 97,351,503 E172* probably null Het
Grhl1 G A 12: 24,584,946 probably null Het
Gtf2ird2 A T 5: 134,197,265 E184V probably benign Het
Hace1 A G 10: 45,700,670 I813V probably benign Het
Hk2 A T 6: 82,738,398 L385Q probably damaging Het
Htt C T 5: 34,819,032 T726I probably benign Het
Itga8 T C 2: 12,140,395 S916G probably benign Het
Jag1 A T 2: 137,093,255 F396I probably damaging Het
Kif16b A G 2: 142,712,979 M633T possibly damaging Het
Klf5 T A 14: 99,301,486 F112I probably damaging Het
Lama1 A T 17: 67,821,615 Q2989L Het
Lrrc28 C A 7: 67,628,294 probably null Het
Map4k5 T C 12: 69,813,157 T739A possibly damaging Het
Mbd3l2 A T 9: 18,444,618 R80* probably null Het
Mctp2 T C 7: 72,103,156 E783G probably damaging Het
Mill2 A T 7: 18,856,564 M190L probably benign Het
N4bp3 T C 11: 51,644,429 N311S probably benign Het
Nanos2 A T 7: 18,987,624 D7V probably damaging Het
Ndufs7 T A 10: 80,253,785 probably null Het
Nexn T C 3: 152,242,669 N483S probably benign Het
Nlrp1b T G 11: 71,182,462 E185A probably damaging Het
Nop2 C A 6: 125,137,155 Q195K probably benign Het
Olfr1234 A G 2: 89,362,613 V272A possibly damaging Het
Olfr732 G A 14: 50,281,495 P253S probably damaging Het
Pde12 G A 14: 26,669,422 S44L probably benign Het
Pde1c A T 6: 56,137,386 V514E probably damaging Het
Pdzph1 A T 17: 58,974,339 V316D probably benign Het
Prl3c1 A T 13: 27,203,595 I208F possibly damaging Het
Raver2 G A 4: 101,107,202 probably null Het
Rpl13a-ps1 T A 19: 50,030,308 H143L probably benign Het
Sept14 A T 5: 129,683,578 I402K possibly damaging Het
Sla2 T A 2: 156,875,965 Y129F possibly damaging Het
Smarca2 TGCAGCAGCAGCAGCAGCA TGCAGCAGCAGCAGCA 19: 26,630,958 probably benign Het
Sorl1 A G 9: 42,000,271 S1448P probably damaging Het
Spast G A 17: 74,388,278 R604H probably damaging Het
Speg G A 1: 75,388,873 G633S probably damaging Het
Stxbp5l ATTTT ATTTTT 16: 37,216,052 probably null Het
Syt11 T C 3: 88,762,028 M186V probably benign Het
Tex26 C A 5: 149,456,904 N133K probably benign Het
Tnfrsf17 T C 16: 11,314,046 C32R probably damaging Het
Trem1 T A 17: 48,237,346 V133E probably damaging Het
Trpm7 A T 2: 126,822,741 M906K possibly damaging Het
Ugt2b35 T A 5: 87,011,330 I461K possibly damaging Het
Vmn2r77 T A 7: 86,795,222 C28S probably damaging Het
Zfp521 C A 18: 13,846,080 L425F probably damaging Het
Zfp790 C T 7: 29,823,100 probably benign Het
Other mutations in Ambn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Ambn APN 5 88459359 missense probably damaging 0.99
IGL01139:Ambn APN 5 88464517 splice site probably benign
IGL01318:Ambn APN 5 88460695 splice site probably benign
IGL02139:Ambn APN 5 88465290 missense probably benign
IGL02261:Ambn APN 5 88456948 missense probably damaging 1.00
IGL02743:Ambn APN 5 88464484 missense probably damaging 0.99
IGL03329:Ambn APN 5 88461668 missense probably benign 0.34
R0242:Ambn UTSW 5 88467972 missense possibly damaging 0.85
R0242:Ambn UTSW 5 88467972 missense possibly damaging 0.85
R0563:Ambn UTSW 5 88463450 missense probably benign 0.28
R1649:Ambn UTSW 5 88464481 missense probably benign 0.16
R2118:Ambn UTSW 5 88460758 splice site probably benign
R2121:Ambn UTSW 5 88460758 splice site probably benign
R2124:Ambn UTSW 5 88460758 splice site probably benign
R2495:Ambn UTSW 5 88467804 missense probably benign 0.05
R2877:Ambn UTSW 5 88460700 splice site probably benign
R3779:Ambn UTSW 5 88465342 splice site probably benign
R4760:Ambn UTSW 5 88467707 missense probably damaging 1.00
R5422:Ambn UTSW 5 88464511 critical splice donor site probably null
R5755:Ambn UTSW 5 88464491 splice site probably null
R5883:Ambn UTSW 5 88467829 nonsense probably null
R5970:Ambn UTSW 5 88467951 missense possibly damaging 0.88
R6846:Ambn UTSW 5 88461715 missense possibly damaging 0.65
R7166:Ambn UTSW 5 88467528 missense possibly damaging 0.94
R7500:Ambn UTSW 5 88461634 missense possibly damaging 0.95
R7809:Ambn UTSW 5 88467824 missense probably benign 0.00
R8306:Ambn UTSW 5 88459422 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGTGTTCCTGGAACTCTTAAAAGTCC -3'
(R):5'- TGCTTTTGACAGAATGTGGAC -3'

Sequencing Primer
(F):5'- AGGCCCTTGGTATTGCAAAGATC -3'
(R):5'- GCTTTTGACAGAATGTGGACTTACC -3'
Posted On 2021-08-02