Incidental Mutation 'R8898:Acan'
ID678177
Institutional Source Beutler Lab
Gene Symbol Acan
Ensembl Gene ENSMUSG00000030607
Gene Nameaggrecan
SynonymsAgc1, b2b183Clo, Cspg1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8898 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location79053483-79115099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 79100353 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 1624 (T1624K)
Ref Sequence ENSEMBL: ENSMUSP00000032835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032835]
AlphaFold Q61282
Predicted Effect possibly damaging
Transcript: ENSMUST00000032835
AA Change: T1624K

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000032835
Gene: ENSMUSG00000030607
AA Change: T1624K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 46 135 3.46e-7 SMART
LINK 151 248 1.76e-59 SMART
LINK 252 350 4.13e-65 SMART
LINK 485 582 1.03e-51 SMART
LINK 586 684 9.58e-61 SMART
low complexity region 767 794 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 890 904 N/A INTRINSIC
low complexity region 913 930 N/A INTRINSIC
low complexity region 966 987 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
low complexity region 1484 1495 N/A INTRINSIC
low complexity region 1707 1720 N/A INTRINSIC
low complexity region 1808 1823 N/A INTRINSIC
low complexity region 1904 1915 N/A INTRINSIC
CLECT 1922 2043 2.13e-37 SMART
CCP 2049 2105 9.32e-11 SMART
low complexity region 2118 2130 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Spontaneous mutations in this gene lead to dwarfism, cartilage, skeletal and limb anomalies, craniofacial defects, hearing loss and neonatal death due to respiratory failure. Homozygotes for an ENU-induced allele show cardiomyopathy as well as cleft palate, disproportionate dwarfism and brachypodia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,661,044 L988* probably null Het
4930546C10Rik A G 18: 68,950,035 F36S unknown Het
Ambn T C 5: 88,465,192 probably null Het
Ankrd24 T C 10: 81,642,518 I437T unknown Het
Arl4d C T 11: 101,667,001 R118W probably damaging Het
Bcan T C 3: 87,988,388 T814A probably benign Het
Brca2 T A 5: 150,569,033 M3171K possibly damaging Het
Cd209a T A 8: 3,748,739 S23C probably damaging Het
Chek2 A T 5: 110,863,309 K324N probably benign Het
Col12a1 C T 9: 79,692,295 V859I probably benign Het
Cyp7b1 C T 3: 18,096,624 R317H probably benign Het
Dmxl2 A G 9: 54,401,657 S1937P probably benign Het
Epb41l1 T G 2: 156,493,949 V11G probably damaging Het
Ephb6 C T 6: 41,613,359 A15V probably benign Het
Fat3 G A 9: 15,947,526 P3798L probably benign Het
Foxd1 T A 13: 98,355,088 C157S probably damaging Het
Gja10 T C 4: 32,601,058 Q442R probably benign Het
Gm17019 A C 5: 15,031,784 M47R possibly damaging Het
Gpr179 C A 11: 97,351,503 E172* probably null Het
Grhl1 G A 12: 24,584,946 probably null Het
Gtf2ird2 A T 5: 134,197,265 E184V probably benign Het
Hace1 A G 10: 45,700,670 I813V probably benign Het
Hk2 A T 6: 82,738,398 L385Q probably damaging Het
Htt C T 5: 34,819,032 T726I probably benign Het
Itga8 T C 2: 12,140,395 S916G probably benign Het
Jag1 A T 2: 137,093,255 F396I probably damaging Het
Kif16b A G 2: 142,712,979 M633T possibly damaging Het
Klf5 T A 14: 99,301,486 F112I probably damaging Het
Lama1 A T 17: 67,821,615 Q2989L Het
Lrrc28 C A 7: 67,628,294 probably null Het
Map4k5 T C 12: 69,813,157 T739A possibly damaging Het
Mbd3l2 A T 9: 18,444,618 R80* probably null Het
Mctp2 T C 7: 72,103,156 E783G probably damaging Het
Mill2 A T 7: 18,856,564 M190L probably benign Het
N4bp3 T C 11: 51,644,429 N311S probably benign Het
Nanos2 A T 7: 18,987,624 D7V probably damaging Het
Ndufs7 T A 10: 80,253,785 probably null Het
Nexn T C 3: 152,242,669 N483S probably benign Het
Nlrp1b T G 11: 71,182,462 E185A probably damaging Het
Nop2 C A 6: 125,137,155 Q195K probably benign Het
Olfr1234 A G 2: 89,362,613 V272A possibly damaging Het
Olfr732 G A 14: 50,281,495 P253S probably damaging Het
Pde12 G A 14: 26,669,422 S44L probably benign Het
Pde1c A T 6: 56,137,386 V514E probably damaging Het
Pdzph1 A T 17: 58,974,339 V316D probably benign Het
Prl3c1 A T 13: 27,203,595 I208F possibly damaging Het
Raver2 G A 4: 101,107,202 probably null Het
Rpl13a-ps1 T A 19: 50,030,308 H143L probably benign Het
Sept14 A T 5: 129,683,578 I402K possibly damaging Het
Sla2 T A 2: 156,875,965 Y129F possibly damaging Het
Smarca2 TGCAGCAGCAGCAGCAGCA TGCAGCAGCAGCAGCA 19: 26,630,958 probably benign Het
Sorl1 A G 9: 42,000,271 S1448P probably damaging Het
Spast G A 17: 74,388,278 R604H probably damaging Het
Speg G A 1: 75,388,873 G633S probably damaging Het
Stxbp5l ATTTT ATTTTT 16: 37,216,052 probably null Het
Syt11 T C 3: 88,762,028 M186V probably benign Het
Tex26 C A 5: 149,456,904 N133K probably benign Het
Tnfrsf17 T C 16: 11,314,046 C32R probably damaging Het
Trem1 T A 17: 48,237,346 V133E probably damaging Het
Trpm7 A T 2: 126,822,741 M906K possibly damaging Het
Ugt2b35 T A 5: 87,011,330 I461K possibly damaging Het
Vmn2r77 T A 7: 86,795,222 C28S probably damaging Het
Zfp521 C A 18: 13,846,080 L425F probably damaging Het
Zfp790 C T 7: 29,823,100 probably benign Het
Other mutations in Acan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Acan APN 7 79097824 missense probably benign 0.00
IGL01118:Acan APN 7 79098653 missense possibly damaging 0.78
IGL01145:Acan APN 7 79099282 missense probably damaging 1.00
IGL01308:Acan APN 7 79099249 missense probably damaging 0.98
IGL01520:Acan APN 7 79084570 missense probably damaging 0.96
IGL02069:Acan APN 7 79092752 missense possibly damaging 0.83
IGL02629:Acan APN 7 79111979 missense possibly damaging 0.90
IGL02713:Acan APN 7 79100244 missense possibly damaging 0.90
IGL03001:Acan APN 7 79111294 missense probably damaging 0.99
IGL03081:Acan APN 7 79098543 missense probably benign 0.01
Disproportion UTSW 7 79092318 missense probably damaging 0.98
Hollowleg UTSW 7 79098348 nonsense probably null
Sublimate UTSW 7 79111320 missense probably damaging 0.97
Vacuo UTSW 7 79088307 critical splice donor site probably null
IGL03147:Acan UTSW 7 79091056 missense probably damaging 1.00
R0281:Acan UTSW 7 79100285 missense probably damaging 1.00
R0372:Acan UTSW 7 79100601 missense probably benign 0.00
R0599:Acan UTSW 7 79111290 splice site probably benign
R0827:Acan UTSW 7 79099671 missense probably benign 0.00
R0835:Acan UTSW 7 79114232 missense probably damaging 0.96
R1496:Acan UTSW 7 79100804 missense probably benign 0.06
R1716:Acan UTSW 7 79082198 missense unknown
R1761:Acan UTSW 7 79094085 nonsense probably null
R1848:Acan UTSW 7 79099035 missense probably benign
R2002:Acan UTSW 7 79100793 missense probably damaging 1.00
R2025:Acan UTSW 7 79101222 missense probably benign
R2167:Acan UTSW 7 79099957 missense probably benign 0.41
R2189:Acan UTSW 7 79098091 missense probably damaging 1.00
R2303:Acan UTSW 7 79099957 missense probably benign 0.41
R2496:Acan UTSW 7 79111317 missense probably damaging 1.00
R2971:Acan UTSW 7 79099699 missense possibly damaging 0.46
R4004:Acan UTSW 7 79100687 missense probably damaging 1.00
R4669:Acan UTSW 7 79101142 missense probably benign 0.01
R4732:Acan UTSW 7 79098609 missense probably damaging 0.99
R4733:Acan UTSW 7 79098609 missense probably damaging 0.99
R4742:Acan UTSW 7 79100769 missense probably benign 0.41
R4750:Acan UTSW 7 79092718 missense probably damaging 1.00
R5022:Acan UTSW 7 79092808 critical splice donor site probably null
R5122:Acan UTSW 7 79100661 missense probably damaging 0.99
R5190:Acan UTSW 7 79098541 missense probably benign 0.03
R5220:Acan UTSW 7 79088297 missense probably damaging 0.96
R5414:Acan UTSW 7 79100988 missense probably benign 0.00
R5525:Acan UTSW 7 79099983 missense probably benign
R5655:Acan UTSW 7 79100043 missense possibly damaging 0.89
R5662:Acan UTSW 7 79100107 missense possibly damaging 0.78
R5748:Acan UTSW 7 79089699 missense probably damaging 0.98
R5758:Acan UTSW 7 79101214 missense possibly damaging 0.67
R5996:Acan UTSW 7 79111320 missense probably damaging 0.97
R6057:Acan UTSW 7 79099782 missense probably null
R6503:Acan UTSW 7 79097832 missense probably benign 0.04
R6529:Acan UTSW 7 79089731 missense probably benign 0.16
R6887:Acan UTSW 7 79092483 missense probably damaging 1.00
R7041:Acan UTSW 7 79098348 nonsense probably null
R7193:Acan UTSW 7 79086342 missense probably damaging 1.00
R7220:Acan UTSW 7 79108148 missense
R7263:Acan UTSW 7 79092318 missense probably damaging 0.98
R7376:Acan UTSW 7 79088307 critical splice donor site probably null
R7502:Acan UTSW 7 79094203 missense probably damaging 1.00
R7571:Acan UTSW 7 79086267 missense probably damaging 1.00
R7709:Acan UTSW 7 79089608 missense probably damaging 1.00
R7835:Acan UTSW 7 79099875 missense probably benign 0.08
R8051:Acan UTSW 7 79100779 missense probably damaging 0.96
R8131:Acan UTSW 7 79091338 missense possibly damaging 0.92
R8138:Acan UTSW 7 79098427 missense probably benign 0.12
R8324:Acan UTSW 7 79091056 missense probably damaging 1.00
R8482:Acan UTSW 7 79096744 missense probably benign 0.02
R8511:Acan UTSW 7 79097935 missense possibly damaging 0.94
R8716:Acan UTSW 7 79112690 missense probably damaging 1.00
R8753:Acan UTSW 7 79098768 missense possibly damaging 0.83
R8810:Acan UTSW 7 79099704 missense probably damaging 1.00
R8956:Acan UTSW 7 79100965 missense probably benign 0.00
RF008:Acan UTSW 7 79092400 missense possibly damaging 0.83
Z1088:Acan UTSW 7 79088200 nonsense probably null
Z1088:Acan UTSW 7 79100110 missense probably benign 0.41
Z1088:Acan UTSW 7 79111354 missense probably benign
Z1176:Acan UTSW 7 79111354 missense probably benign
Z1177:Acan UTSW 7 79094170 missense probably damaging 0.96
Z1177:Acan UTSW 7 79100137 missense probably damaging 0.99
Z1177:Acan UTSW 7 79111354 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCAGGAGCATTTGATGGCAG -3'
(R):5'- GGAAACAGTGGGTTCAGTCAC -3'

Sequencing Primer
(F):5'- AGCATTTGATGGCAGTGGAC -3'
(R):5'- AGTGGGTTCAGTCACACCCTC -3'
Posted On2021-08-02