Incidental Mutation 'R8898:Pdzph1'
ID 678203
Institutional Source Beutler Lab
Gene Symbol Pdzph1
Ensembl Gene ENSMUSG00000024227
Gene Name PDZ and pleckstrin homology domains 1
Synonyms 2610034M16Rik
MMRRC Submission 068755-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R8898 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 59185803-59298344 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 59281334 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 316 (V316D)
Ref Sequence ENSEMBL: ENSMUSP00000025064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025064]
AlphaFold Q8BGR1
Predicted Effect probably benign
Transcript: ENSMUST00000025064
AA Change: V316D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000025064
Gene: ENSMUSG00000024227
AA Change: V316D

DomainStartEndE-ValueType
Blast:PDZ 780 844 6e-20 BLAST
PDZ 915 984 3.31e-15 SMART
PH 993 1096 9.4e-19 SMART
PH 1120 1218 2.83e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,383,001 (GRCm39) L988* probably null Het
4930546C10Rik A G 18: 69,083,106 (GRCm39) F36S unknown Het
Acan C A 7: 78,750,101 (GRCm39) T1624K possibly damaging Het
Ambn T C 5: 88,613,051 (GRCm39) probably null Het
Ankrd24 T C 10: 81,478,352 (GRCm39) I437T unknown Het
Arl4d C T 11: 101,557,827 (GRCm39) R118W probably damaging Het
Atg2a A G 19: 6,306,721 (GRCm39) probably benign Het
Bcan T C 3: 87,895,695 (GRCm39) T814A probably benign Het
Brca2 T A 5: 150,492,498 (GRCm39) M3171K possibly damaging Het
Cd209a T A 8: 3,798,739 (GRCm39) S23C probably damaging Het
Chek2 A T 5: 111,011,175 (GRCm39) K324N probably benign Het
Col12a1 C T 9: 79,599,577 (GRCm39) V859I probably benign Het
Cyp7b1 C T 3: 18,150,788 (GRCm39) R317H probably benign Het
Dmxl2 A G 9: 54,308,941 (GRCm39) S1937P probably benign Het
Epb41l1 T G 2: 156,335,869 (GRCm39) V11G probably damaging Het
Ephb6 C T 6: 41,590,293 (GRCm39) A15V probably benign Het
Fat3 G A 9: 15,858,822 (GRCm39) P3798L probably benign Het
Foxd1 T A 13: 98,491,596 (GRCm39) C157S probably damaging Het
Gja10 T C 4: 32,601,058 (GRCm39) Q442R probably benign Het
Gm17019 A C 5: 15,081,798 (GRCm39) M47R possibly damaging Het
Gpr179 C A 11: 97,242,329 (GRCm39) E172* probably null Het
Grhl1 G A 12: 24,634,945 (GRCm39) probably null Het
Gtf2ird2 A T 5: 134,226,106 (GRCm39) E184V probably benign Het
Hace1 A G 10: 45,576,766 (GRCm39) I813V probably benign Het
Hk2 A T 6: 82,715,379 (GRCm39) L385Q probably damaging Het
Htt C T 5: 34,976,376 (GRCm39) T726I probably benign Het
Itga8 T C 2: 12,145,206 (GRCm39) S916G probably benign Het
Jag1 A T 2: 136,935,175 (GRCm39) F396I probably damaging Het
Kif16b A G 2: 142,554,899 (GRCm39) M633T possibly damaging Het
Klf5 T A 14: 99,538,922 (GRCm39) F112I probably damaging Het
Lama1 A T 17: 68,128,610 (GRCm39) Q2989L Het
Lrrc28 C A 7: 67,278,042 (GRCm39) probably null Het
Map4k5 T C 12: 69,859,931 (GRCm39) T739A possibly damaging Het
Mbd3l2 A T 9: 18,355,914 (GRCm39) R80* probably null Het
Mctp2 T C 7: 71,752,904 (GRCm39) E783G probably damaging Het
Mill2 A T 7: 18,590,489 (GRCm39) M190L probably benign Het
N4bp3 T C 11: 51,535,256 (GRCm39) N311S probably benign Het
Nanos2 A T 7: 18,721,549 (GRCm39) D7V probably damaging Het
Ndufs7 T A 10: 80,089,619 (GRCm39) probably null Het
Nexn T C 3: 151,948,306 (GRCm39) N483S probably benign Het
Nlrp1b T G 11: 71,073,288 (GRCm39) E185A probably damaging Het
Nop2 C A 6: 125,114,118 (GRCm39) Q195K probably benign Het
Or4a15 A G 2: 89,192,957 (GRCm39) V272A possibly damaging Het
Or4n4 G A 14: 50,518,952 (GRCm39) P253S probably damaging Het
Pde12 G A 14: 26,390,577 (GRCm39) S44L probably benign Het
Pde1c A T 6: 56,114,371 (GRCm39) V514E probably damaging Het
Prl3c1 A T 13: 27,387,578 (GRCm39) I208F possibly damaging Het
Raver2 G A 4: 100,964,399 (GRCm39) probably null Het
Rpl13a-ps1 T A 19: 50,018,747 (GRCm39) H143L probably benign Het
Septin14 A T 5: 129,760,642 (GRCm39) I402K possibly damaging Het
Sla2 T A 2: 156,717,885 (GRCm39) Y129F possibly damaging Het
Smarca2 TGCAGCAGCAGCAGCAGCA TGCAGCAGCAGCAGCA 19: 26,608,358 (GRCm39) probably benign Het
Sorl1 A G 9: 41,911,567 (GRCm39) S1448P probably damaging Het
Spast G A 17: 74,695,273 (GRCm39) R604H probably damaging Het
Speg G A 1: 75,365,517 (GRCm39) G633S probably damaging Het
Stxbp5l ATTTT ATTTTT 16: 37,036,414 (GRCm39) probably null Het
Syt11 T C 3: 88,669,335 (GRCm39) M186V probably benign Het
Tex26 C A 5: 149,380,369 (GRCm39) N133K probably benign Het
Tnfrsf17 T C 16: 11,131,910 (GRCm39) C32R probably damaging Het
Trem1 T A 17: 48,544,374 (GRCm39) V133E probably damaging Het
Trpm7 A T 2: 126,664,661 (GRCm39) M906K possibly damaging Het
Ugt2b35 T A 5: 87,159,189 (GRCm39) I461K possibly damaging Het
Vmn2r77 T A 7: 86,444,430 (GRCm39) C28S probably damaging Het
Zfp521 C A 18: 13,979,137 (GRCm39) L425F probably damaging Het
Zfp790 C T 7: 29,522,525 (GRCm39) probably benign Het
Other mutations in Pdzph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Pdzph1 APN 17 59,281,791 (GRCm39) missense possibly damaging 0.46
IGL00644:Pdzph1 APN 17 59,195,105 (GRCm39) missense probably benign
IGL01413:Pdzph1 APN 17 59,186,147 (GRCm39) missense possibly damaging 0.82
IGL01530:Pdzph1 APN 17 59,229,710 (GRCm39) missense probably damaging 1.00
IGL02089:Pdzph1 APN 17 59,274,334 (GRCm39) missense possibly damaging 0.92
IGL02201:Pdzph1 APN 17 59,274,506 (GRCm39) splice site probably benign
IGL02548:Pdzph1 APN 17 59,280,386 (GRCm39) missense probably benign 0.10
IGL02618:Pdzph1 APN 17 59,186,068 (GRCm39) utr 3 prime probably benign
IGL02660:Pdzph1 APN 17 59,187,642 (GRCm39) missense probably damaging 0.97
IGL02749:Pdzph1 APN 17 59,239,478 (GRCm39) missense possibly damaging 0.95
IGL02876:Pdzph1 APN 17 59,281,064 (GRCm39) missense probably benign
IGL03304:Pdzph1 APN 17 59,187,641 (GRCm39) missense probably damaging 1.00
IGL03336:Pdzph1 APN 17 59,281,229 (GRCm39) missense probably benign 0.00
R0008:Pdzph1 UTSW 17 59,229,756 (GRCm39) splice site probably benign
R0008:Pdzph1 UTSW 17 59,229,756 (GRCm39) splice site probably benign
R0498:Pdzph1 UTSW 17 59,280,825 (GRCm39) missense probably benign 0.00
R0553:Pdzph1 UTSW 17 59,229,722 (GRCm39) missense probably damaging 1.00
R0594:Pdzph1 UTSW 17 59,261,474 (GRCm39) missense possibly damaging 0.76
R1306:Pdzph1 UTSW 17 59,239,427 (GRCm39) missense possibly damaging 0.90
R1370:Pdzph1 UTSW 17 59,281,082 (GRCm39) missense possibly damaging 0.73
R1382:Pdzph1 UTSW 17 59,281,742 (GRCm39) missense probably benign 0.10
R1463:Pdzph1 UTSW 17 59,239,440 (GRCm39) missense probably damaging 1.00
R1766:Pdzph1 UTSW 17 59,280,747 (GRCm39) missense probably benign 0.16
R1773:Pdzph1 UTSW 17 59,281,808 (GRCm39) missense probably damaging 0.98
R1862:Pdzph1 UTSW 17 59,229,578 (GRCm39) missense probably damaging 1.00
R2070:Pdzph1 UTSW 17 59,281,092 (GRCm39) missense probably benign 0.04
R2071:Pdzph1 UTSW 17 59,281,092 (GRCm39) missense probably benign 0.04
R2229:Pdzph1 UTSW 17 59,239,407 (GRCm39) splice site probably benign
R2264:Pdzph1 UTSW 17 59,195,162 (GRCm39) critical splice acceptor site probably null
R2334:Pdzph1 UTSW 17 59,229,644 (GRCm39) missense probably damaging 1.00
R3750:Pdzph1 UTSW 17 59,280,331 (GRCm39) nonsense probably null
R4700:Pdzph1 UTSW 17 59,281,541 (GRCm39) missense probably damaging 0.98
R4847:Pdzph1 UTSW 17 59,280,525 (GRCm39) missense possibly damaging 0.95
R4868:Pdzph1 UTSW 17 59,281,751 (GRCm39) missense probably benign 0.00
R5130:Pdzph1 UTSW 17 59,229,604 (GRCm39) missense probably damaging 1.00
R5329:Pdzph1 UTSW 17 59,281,875 (GRCm39) missense probably damaging 1.00
R5574:Pdzph1 UTSW 17 59,280,942 (GRCm39) missense probably benign 0.00
R5770:Pdzph1 UTSW 17 59,186,146 (GRCm39) missense probably damaging 1.00
R5795:Pdzph1 UTSW 17 59,192,862 (GRCm39) missense possibly damaging 0.47
R5842:Pdzph1 UTSW 17 59,281,407 (GRCm39) missense possibly damaging 0.64
R5851:Pdzph1 UTSW 17 59,280,741 (GRCm39) missense probably benign 0.02
R6158:Pdzph1 UTSW 17 59,280,622 (GRCm39) missense probably damaging 0.96
R6813:Pdzph1 UTSW 17 59,281,431 (GRCm39) missense probably benign 0.08
R7022:Pdzph1 UTSW 17 59,281,121 (GRCm39) missense probably benign 0.02
R7395:Pdzph1 UTSW 17 59,186,154 (GRCm39) missense possibly damaging 0.85
R7525:Pdzph1 UTSW 17 59,274,336 (GRCm39) missense possibly damaging 0.73
R7944:Pdzph1 UTSW 17 59,239,455 (GRCm39) missense probably damaging 1.00
R7945:Pdzph1 UTSW 17 59,239,455 (GRCm39) missense probably damaging 1.00
R7992:Pdzph1 UTSW 17 59,186,105 (GRCm39) missense possibly damaging 0.71
R8016:Pdzph1 UTSW 17 59,239,476 (GRCm39) missense probably damaging 0.98
R8116:Pdzph1 UTSW 17 59,282,138 (GRCm39) missense probably benign 0.01
R8273:Pdzph1 UTSW 17 59,280,009 (GRCm39) missense probably benign 0.00
R8523:Pdzph1 UTSW 17 59,191,008 (GRCm39) missense probably damaging 1.00
R8819:Pdzph1 UTSW 17 59,187,715 (GRCm39) nonsense probably null
R8820:Pdzph1 UTSW 17 59,187,715 (GRCm39) nonsense probably null
R8839:Pdzph1 UTSW 17 59,257,237 (GRCm39) missense probably benign 0.02
R8871:Pdzph1 UTSW 17 59,195,033 (GRCm39) missense probably damaging 1.00
R8959:Pdzph1 UTSW 17 59,281,599 (GRCm39) missense probably damaging 0.97
R9043:Pdzph1 UTSW 17 59,280,535 (GRCm39) missense probably benign 0.05
R9083:Pdzph1 UTSW 17 59,261,395 (GRCm39) missense possibly damaging 0.94
R9092:Pdzph1 UTSW 17 59,280,125 (GRCm39) missense probably damaging 1.00
R9682:Pdzph1 UTSW 17 59,257,262 (GRCm39) missense probably damaging 1.00
R9757:Pdzph1 UTSW 17 59,281,898 (GRCm39) nonsense probably null
R9774:Pdzph1 UTSW 17 59,281,751 (GRCm39) missense probably benign 0.00
X0028:Pdzph1 UTSW 17 59,186,116 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGGTGATATTTTCCCTGACATC -3'
(R):5'- GAAGAGGCCCCTTGAAACAC -3'

Sequencing Primer
(F):5'- AAACTCGTGGTCCTTAAGGTTTCAG -3'
(R):5'- CACCACGGATGAACCCTGTG -3'
Posted On 2021-08-02