Incidental Mutation 'R8902:Unc13c'
ID678250
Institutional Source Beutler Lab
Gene Symbol Unc13c
Ensembl Gene ENSMUSG00000062151
Gene Nameunc-13 homolog C (C. elegans)
SynonymsMunc13-3, Unc13h3, 1500037O19Rik, D9Ertd414e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8902 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location73479422-73968966 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73749548 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 1124 (C1124R)
Ref Sequence ENSEMBL: ENSMUSP00000074726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075245] [ENSMUST00000184666]
Predicted Effect probably damaging
Transcript: ENSMUST00000075245
AA Change: C1124R

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074726
Gene: ENSMUSG00000062151
AA Change: C1124R

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1883 2023 2.6e-50 PFAM
C2 2058 2164 4.15e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184666
AA Change: C1124R

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139027
Gene: ENSMUSG00000062151
AA Change: C1124R

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1882 2024 8.3e-59 PFAM
C2 2058 2164 4.15e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice demonstrate an impaired ability to learn complex motor tasks, putatively due to an observed increase in paired-pulse facilitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 G T 4: 155,905,914 R819L possibly damaging Het
App A G 16: 85,079,879 V208A unknown Het
C1qtnf7 G A 5: 43,615,862 E168K probably damaging Het
Cacna1e C T 1: 154,473,886 M757I probably benign Het
Casp1 A G 9: 5,299,333 T21A probably benign Het
Ccdc92 C T 5: 124,835,641 A275T possibly damaging Het
Ccr4 T A 9: 114,496,552 probably benign Het
Cct8l1 C T 5: 25,517,910 T541I probably benign Het
Chrng G T 1: 87,210,675 R396L possibly damaging Het
Cmip A G 8: 117,377,186 T50A probably damaging Het
Ddx21 C A 10: 62,598,707 S91I probably benign Het
Dnmbp A G 19: 43,901,786 L514P probably benign Het
Echs1 A T 7: 140,110,586 M191K probably damaging Het
Eps8 A G 6: 137,512,177 S408P probably damaging Het
Fat2 T C 11: 55,310,070 E726G probably damaging Het
Fpr2 T C 17: 17,892,928 I62T probably benign Het
Gemin4 G A 11: 76,212,022 Q638* probably null Het
Glrb A T 3: 80,861,978 N147K probably damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gtf2i T C 5: 134,249,866 N637S probably benign Het
Hivep3 A G 4: 120,096,740 E751G possibly damaging Het
Ifnb1 G T 4: 88,522,310 N155K probably damaging Het
Igf2bp3 G T 6: 49,088,431 T509K probably damaging Het
Igsf10 T C 3: 59,336,212 M234V probably benign Het
Iqgap2 C T 13: 95,682,203 A682T probably benign Het
Ireb2 T G 9: 54,892,502 M409R probably benign Het
Kat6b C T 14: 21,669,561 T1327I probably benign Het
Krtap5-5 A G 7: 142,229,893 S7P unknown Het
Lelp1 A T 3: 92,135,671 C24S unknown Het
Malrd1 A T 2: 16,255,334 K2122* probably null Het
Mei1 C A 15: 82,070,011 R6S unknown Het
Meis3 T A 7: 16,177,962 I119N probably benign Het
Mmp20 T C 9: 7,639,287 V152A probably benign Het
Muc6 T A 7: 141,647,524 I797F possibly damaging Het
Myo7a C T 7: 98,092,613 E439K probably damaging Het
Neb C A 2: 52,243,210 A3439S probably damaging Het
Nfe2l1 T A 11: 96,817,794 D715V unknown Het
Obscn C A 11: 59,135,936 R147L probably benign Het
Olfr10 A T 11: 49,318,379 T278S probably benign Het
Olfr1166 A G 2: 88,124,434 S184P probably damaging Het
Olfr126 T A 17: 37,851,210 M206K probably benign Het
Olfr1507 G A 14: 52,490,553 T137I probably benign Het
Olfr164 T A 16: 19,286,633 I37F probably damaging Het
Plg T A 17: 12,410,903 F608Y probably benign Het
Plppr1 C A 4: 49,319,836 P154Q probably damaging Het
Ppp2r5e T C 12: 75,453,796 K441R probably benign Het
Prkaca T C 8: 83,977,085 S5P probably benign Het
Rbl1 T C 2: 157,199,500 K69R probably benign Het
Rbpms2 T C 9: 65,651,069 I129T probably benign Het
Serpina1c A T 12: 103,898,858 N176K probably damaging Het
Sgsm3 C T 15: 81,006,595 H117Y probably damaging Het
Sphkap A T 1: 83,278,964 C355S probably benign Het
Stpg2 T A 3: 139,298,409 V249E probably damaging Het
Syt2 T C 1: 134,747,653 V414A possibly damaging Het
Tiam2 T C 17: 3,477,196 I1050T probably benign Het
Tmem131 A T 1: 36,808,965 I1134N probably damaging Het
Ttc23 A G 7: 67,693,013 E293G Het
Ttc41 C A 10: 86,713,001 R20S probably benign Het
Ttn C T 2: 76,740,789 V26587M probably damaging Het
Ugt2a2 T C 5: 87,460,411 K523R possibly damaging Het
Ush2a T A 1: 188,443,084 N1126K probably damaging Het
Usp36 A T 11: 118,275,014 L326Q probably damaging Het
Zfp568 T C 7: 30,013,882 M120T probably benign Het
Zfp944 T C 17: 22,339,780 D162G probably benign Het
Other mutations in Unc13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Unc13c APN 9 73736703 missense probably damaging 0.99
IGL00693:Unc13c APN 9 73758602 missense probably benign 0.18
IGL01022:Unc13c APN 9 73517328 missense probably benign 0.06
IGL01088:Unc13c APN 9 73932281 missense possibly damaging 0.63
IGL01123:Unc13c APN 9 73933197 missense probably benign 0.05
IGL01131:Unc13c APN 9 73564053 missense probably benign
IGL01135:Unc13c APN 9 73484893 missense probably damaging 1.00
IGL01393:Unc13c APN 9 73540270 missense probably benign 0.06
IGL01752:Unc13c APN 9 73931811 missense probably benign 0.01
IGL01893:Unc13c APN 9 73693366 missense probably benign 0.15
IGL01897:Unc13c APN 9 73546027 missense probably damaging 0.99
IGL01936:Unc13c APN 9 73693242 missense probably benign 0.07
IGL02122:Unc13c APN 9 73734397 splice site probably benign
IGL02341:Unc13c APN 9 73933210 missense possibly damaging 0.76
IGL02434:Unc13c APN 9 73932628 missense probably benign 0.01
IGL02545:Unc13c APN 9 73481075 missense probably damaging 0.98
IGL02709:Unc13c APN 9 73558956 missense probably benign 0.00
IGL02815:Unc13c APN 9 73540263 missense possibly damaging 0.83
IGL02904:Unc13c APN 9 73481067 nonsense probably null
IGL03117:Unc13c APN 9 73534025 missense probably benign 0.03
IGL03260:Unc13c APN 9 73931344 missense probably benign 0.11
feeling UTSW 9 73693271 missense possibly damaging 0.46
Inkling UTSW 9 73931844 missense probably damaging 1.00
notion UTSW 9 73736562 missense probably damaging 1.00
BB001:Unc13c UTSW 9 73734408 missense probably benign 0.05
BB011:Unc13c UTSW 9 73734408 missense probably benign 0.05
PIT4431001:Unc13c UTSW 9 73749547 missense probably damaging 0.99
PIT4651001:Unc13c UTSW 9 73483739 missense possibly damaging 0.48
R0017:Unc13c UTSW 9 73693301 missense probably benign 0.07
R0039:Unc13c UTSW 9 73669565 splice site probably benign
R0164:Unc13c UTSW 9 73694892 missense probably benign 0.01
R0164:Unc13c UTSW 9 73694892 missense probably benign 0.01
R0308:Unc13c UTSW 9 73481118 missense probably benign 0.04
R0344:Unc13c UTSW 9 73930785 missense probably benign 0.39
R0421:Unc13c UTSW 9 73933210 missense possibly damaging 0.76
R0606:Unc13c UTSW 9 73530983 splice site probably benign
R0655:Unc13c UTSW 9 73930953 missense probably damaging 0.96
R1013:Unc13c UTSW 9 73933332 missense probably benign 0.45
R1293:Unc13c UTSW 9 73574074 missense probably benign 0.06
R1493:Unc13c UTSW 9 73639068 missense probably benign 0.27
R1675:Unc13c UTSW 9 73639050 critical splice donor site probably null
R1789:Unc13c UTSW 9 73756339 missense possibly damaging 0.92
R2001:Unc13c UTSW 9 73483615 splice site probably null
R2055:Unc13c UTSW 9 73736550 missense probably damaging 1.00
R2060:Unc13c UTSW 9 73665656 missense probably damaging 0.99
R2420:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R2421:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R2422:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R3415:Unc13c UTSW 9 73932586 missense probably benign 0.00
R3423:Unc13c UTSW 9 73930653 missense possibly damaging 0.46
R3820:Unc13c UTSW 9 73930958 missense probably benign 0.00
R3857:Unc13c UTSW 9 73699108 nonsense probably null
R3859:Unc13c UTSW 9 73699108 nonsense probably null
R3895:Unc13c UTSW 9 73933523 missense probably benign
R4038:Unc13c UTSW 9 73533906 critical splice donor site probably null
R4077:Unc13c UTSW 9 73736539 nonsense probably null
R4125:Unc13c UTSW 9 73574007 critical splice donor site probably null
R4128:Unc13c UTSW 9 73734537 missense probably damaging 1.00
R4235:Unc13c UTSW 9 73530952 missense possibly damaging 0.68
R4295:Unc13c UTSW 9 73734504 missense probably damaging 1.00
R4307:Unc13c UTSW 9 73693367 missense probably benign 0.06
R4658:Unc13c UTSW 9 73932826 missense probably damaging 1.00
R4694:Unc13c UTSW 9 73572354 missense probably benign 0.00
R4735:Unc13c UTSW 9 73693338 missense probably benign 0.00
R4744:Unc13c UTSW 9 73931844 missense probably damaging 1.00
R4795:Unc13c UTSW 9 73932187 missense probably damaging 0.97
R4827:Unc13c UTSW 9 73931286 missense probably damaging 1.00
R4838:Unc13c UTSW 9 73932072 missense possibly damaging 0.68
R4869:Unc13c UTSW 9 73680434 missense probably benign 0.02
R4873:Unc13c UTSW 9 73517284 missense probably damaging 0.98
R4875:Unc13c UTSW 9 73517284 missense probably damaging 0.98
R4876:Unc13c UTSW 9 73749539 missense probably damaging 1.00
R4905:Unc13c UTSW 9 73680392 missense probably benign
R4912:Unc13c UTSW 9 73574022 missense probably damaging 0.99
R5026:Unc13c UTSW 9 73930903 missense possibly damaging 0.74
R5127:Unc13c UTSW 9 73933372 missense probably benign 0.26
R5151:Unc13c UTSW 9 73931475 missense probably benign 0.02
R5171:Unc13c UTSW 9 73757954 missense probably benign
R5244:Unc13c UTSW 9 73525951 critical splice donor site probably null
R5342:Unc13c UTSW 9 73930823 missense probably benign 0.00
R5399:Unc13c UTSW 9 73749688 missense possibly damaging 0.95
R5409:Unc13c UTSW 9 73578390 missense possibly damaging 0.78
R5460:Unc13c UTSW 9 73545989 missense probably benign
R5680:Unc13c UTSW 9 73932602 missense probably damaging 1.00
R5681:Unc13c UTSW 9 73546075 splice site probably null
R5728:Unc13c UTSW 9 73558956 missense probably benign 0.01
R5762:Unc13c UTSW 9 73812367 missense probably benign 0.00
R5764:Unc13c UTSW 9 73533903 splice site probably null
R5829:Unc13c UTSW 9 73693368 missense probably benign 0.15
R5894:Unc13c UTSW 9 73693204 critical splice donor site probably null
R5936:Unc13c UTSW 9 73578492 missense probably damaging 1.00
R6043:Unc13c UTSW 9 73736651 missense possibly damaging 0.88
R6046:Unc13c UTSW 9 73930884 missense probably benign
R6148:Unc13c UTSW 9 73693366 missense probably benign 0.15
R6207:Unc13c UTSW 9 73758628 missense possibly damaging 0.89
R6277:Unc13c UTSW 9 73699169 missense probably damaging 1.00
R6338:Unc13c UTSW 9 73734447 missense probably damaging 0.99
R6615:Unc13c UTSW 9 73930608 missense possibly damaging 0.63
R6978:Unc13c UTSW 9 73931977 missense probably benign 0.39
R7053:Unc13c UTSW 9 73932297 missense probably damaging 1.00
R7223:Unc13c UTSW 9 73629191 missense probably benign 0.44
R7259:Unc13c UTSW 9 73517363 missense probably benign 0.00
R7353:Unc13c UTSW 9 73574073 missense probably benign 0.00
R7357:Unc13c UTSW 9 73933528 small insertion probably benign
R7357:Unc13c UTSW 9 73933529 small insertion probably benign
R7607:Unc13c UTSW 9 73669535 missense probably damaging 0.98
R7626:Unc13c UTSW 9 73734517 missense probably damaging 1.00
R7639:Unc13c UTSW 9 73933168 missense probably damaging 0.99
R7657:Unc13c UTSW 9 73533903 splice site probably null
R7665:Unc13c UTSW 9 73680474 missense probably benign 0.28
R7704:Unc13c UTSW 9 73699212 missense probably benign 0.27
R7776:Unc13c UTSW 9 73694950 missense probably damaging 1.00
R7811:Unc13c UTSW 9 73693271 missense possibly damaging 0.46
R7833:Unc13c UTSW 9 73481109 missense possibly damaging 0.53
R7839:Unc13c UTSW 9 73933314 missense possibly damaging 0.63
R7869:Unc13c UTSW 9 73694877 missense probably damaging 1.00
R7924:Unc13c UTSW 9 73734408 missense probably benign 0.05
R8047:Unc13c UTSW 9 73812354 nonsense probably null
R8167:Unc13c UTSW 9 73736703 missense probably damaging 0.99
R8202:Unc13c UTSW 9 73736562 missense probably damaging 1.00
R8210:Unc13c UTSW 9 73484938 missense probably benign 0.13
R8352:Unc13c UTSW 9 73931008 missense probably damaging 0.99
R8368:Unc13c UTSW 9 73930788 missense probably benign 0.15
R8452:Unc13c UTSW 9 73931008 missense probably damaging 0.99
R8535:Unc13c UTSW 9 73540371 missense probably benign
R8677:Unc13c UTSW 9 73932961 missense probably benign 0.00
R8700:Unc13c UTSW 9 73572397 missense probably benign 0.44
R8848:Unc13c UTSW 9 73525981 missense probably benign
R8953:Unc13c UTSW 9 73932762 missense probably benign 0.00
R8961:Unc13c UTSW 9 73932242 missense probably benign 0.06
R9015:Unc13c UTSW 9 73546040 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCAAGTCCATGACTGGTCG -3'
(R):5'- AGCCACTGATTTGCTTTGCC -3'

Sequencing Primer
(F):5'- ATGACTGGTCGGCCATCAGTG -3'
(R):5'- CTTGTTCCCGCTCTTAAACTCACAG -3'
Posted On2021-08-02