Incidental Mutation 'R8902:Ttc41'
ID 678253
Institutional Source Beutler Lab
Gene Symbol Ttc41
Ensembl Gene ENSMUSG00000044937
Gene Name tetratricopeptide repeat domain 41
Synonyms Gnn, BC030307
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock # R8902 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 86705811-86776844 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 86713001 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Serine at position 20 (R20S)
Ref Sequence ENSEMBL: ENSMUSP00000075059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061458] [ENSMUST00000075632] [ENSMUST00000217747] [ENSMUST00000219108]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000061458
AA Change: R20S

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000062844
Gene: ENSMUSG00000044937
AA Change: R20S

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Blast:AAA 336 401 9e-8 BLAST
SCOP:d1jpna2 338 370 1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075632
AA Change: R20S

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937
AA Change: R20S

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Pfam:NACHT 337 515 5.4e-10 PFAM
SCOP:d1qqea_ 805 1028 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217747
AA Change: R20S

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000219108
AA Change: R20S

PolyPhen 2 Score 0.167 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 G T 4: 155,905,914 R819L possibly damaging Het
App A G 16: 85,079,879 V208A unknown Het
C1qtnf7 G A 5: 43,615,862 E168K probably damaging Het
Cacna1e C T 1: 154,473,886 M757I probably benign Het
Casp1 A G 9: 5,299,333 T21A probably benign Het
Ccdc92 C T 5: 124,835,641 A275T possibly damaging Het
Ccr4 T A 9: 114,496,552 probably benign Het
Cct8l1 C T 5: 25,517,910 T541I probably benign Het
Chrng G T 1: 87,210,675 R396L possibly damaging Het
Cmip A G 8: 117,377,186 T50A probably damaging Het
Ddx21 C A 10: 62,598,707 S91I probably benign Het
Dnmbp A G 19: 43,901,786 L514P probably benign Het
Echs1 A T 7: 140,110,586 M191K probably damaging Het
Eps8 A G 6: 137,512,177 S408P probably damaging Het
Fat2 T C 11: 55,310,070 E726G probably damaging Het
Fpr2 T C 17: 17,892,928 I62T probably benign Het
Gemin4 G A 11: 76,212,022 Q638* probably null Het
Glrb A T 3: 80,861,978 N147K probably damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gtf2i T C 5: 134,249,866 N637S probably benign Het
Hivep3 A G 4: 120,096,740 E751G possibly damaging Het
Ifnb1 G T 4: 88,522,310 N155K probably damaging Het
Igf2bp3 G T 6: 49,088,431 T509K probably damaging Het
Igsf10 T C 3: 59,336,212 M234V probably benign Het
Iqgap2 C T 13: 95,682,203 A682T probably benign Het
Ireb2 T G 9: 54,892,502 M409R probably benign Het
Kat6b C T 14: 21,669,561 T1327I probably benign Het
Krtap5-5 A G 7: 142,229,893 S7P unknown Het
Lelp1 A T 3: 92,135,671 C24S unknown Het
Malrd1 A T 2: 16,255,334 K2122* probably null Het
Mei1 C A 15: 82,070,011 R6S unknown Het
Meis3 T A 7: 16,177,962 I119N probably benign Het
Mmp20 T C 9: 7,639,287 V152A probably benign Het
Muc6 T A 7: 141,647,524 I797F possibly damaging Het
Myo7a C T 7: 98,092,613 E439K probably damaging Het
Neb C A 2: 52,243,210 A3439S probably damaging Het
Nfe2l1 T A 11: 96,817,794 D715V unknown Het
Obscn C A 11: 59,135,936 R147L probably benign Het
Olfr10 A T 11: 49,318,379 T278S probably benign Het
Olfr1166 A G 2: 88,124,434 S184P probably damaging Het
Olfr126 T A 17: 37,851,210 M206K probably benign Het
Olfr1507 G A 14: 52,490,553 T137I probably benign Het
Olfr164 T A 16: 19,286,633 I37F probably damaging Het
Plg T A 17: 12,410,903 F608Y probably benign Het
Plppr1 C A 4: 49,319,836 P154Q probably damaging Het
Ppp2r5e T C 12: 75,453,796 K441R probably benign Het
Prkaca T C 8: 83,977,085 S5P probably benign Het
Rbl1 T C 2: 157,199,500 K69R probably benign Het
Rbpms2 T C 9: 65,651,069 I129T probably benign Het
Serpina1c A T 12: 103,898,858 N176K probably damaging Het
Sgsm3 C T 15: 81,006,595 H117Y probably damaging Het
Sphkap A T 1: 83,278,964 C355S probably benign Het
Stpg2 T A 3: 139,298,409 V249E probably damaging Het
Syt2 T C 1: 134,747,653 V414A possibly damaging Het
Tiam2 T C 17: 3,477,196 I1050T probably benign Het
Tmem131 A T 1: 36,808,965 I1134N probably damaging Het
Ttc23 A G 7: 67,693,013 E293G Het
Ttn C T 2: 76,740,789 V26587M probably damaging Het
Ugt2a2 T C 5: 87,460,411 K523R possibly damaging Het
Unc13c A G 9: 73,749,548 C1124R probably damaging Het
Ush2a T A 1: 188,443,084 N1126K probably damaging Het
Usp36 A T 11: 118,275,014 L326Q probably damaging Het
Zfp568 T C 7: 30,013,882 M120T probably benign Het
Zfp944 T C 17: 22,339,780 D162G probably benign Het
Other mutations in Ttc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Ttc41 APN 10 86736933 missense possibly damaging 0.71
IGL01373:Ttc41 APN 10 86775957 missense possibly damaging 0.61
IGL01636:Ttc41 APN 10 86776678 missense probably benign
IGL01707:Ttc41 APN 10 86776767 missense probably damaging 1.00
IGL01814:Ttc41 APN 10 86731026 missense probably damaging 0.98
IGL01845:Ttc41 APN 10 86776624 missense probably benign 0.03
IGL01918:Ttc41 APN 10 86713190 missense probably damaging 1.00
IGL02374:Ttc41 APN 10 86775951 missense probably damaging 1.00
IGL02489:Ttc41 APN 10 86760914 nonsense probably null
IGL02887:Ttc41 APN 10 86733654 missense probably damaging 1.00
IGL03061:Ttc41 APN 10 86736857 missense possibly damaging 0.65
IGL03077:Ttc41 APN 10 86758348 missense probably damaging 1.00
IGL03210:Ttc41 APN 10 86724414 critical splice donor site probably null
IGL03242:Ttc41 APN 10 86776819 makesense probably null
IGL03307:Ttc41 APN 10 86744440 missense possibly damaging 0.76
BB003:Ttc41 UTSW 10 86776047 missense probably benign 0.10
BB013:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0071:Ttc41 UTSW 10 86736846 missense probably benign 0.01
R0379:Ttc41 UTSW 10 86712977 missense possibly damaging 0.65
R0384:Ttc41 UTSW 10 86763947 missense probably damaging 1.00
R0545:Ttc41 UTSW 10 86759097 missense probably benign 0.00
R1589:Ttc41 UTSW 10 86776390 missense probably benign 0.01
R1599:Ttc41 UTSW 10 86776573 missense probably benign 0.04
R1608:Ttc41 UTSW 10 86775993 missense probably damaging 1.00
R1670:Ttc41 UTSW 10 86776252 missense possibly damaging 0.93
R1938:Ttc41 UTSW 10 86776214 missense probably benign
R2398:Ttc41 UTSW 10 86713386 missense possibly damaging 0.91
R2401:Ttc41 UTSW 10 86724374 missense probably benign 0.42
R3117:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R3119:Ttc41 UTSW 10 86724320 missense possibly damaging 0.62
R4805:Ttc41 UTSW 10 86729798 missense possibly damaging 0.62
R4840:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4841:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4842:Ttc41 UTSW 10 86731125 missense probably benign 0.10
R4884:Ttc41 UTSW 10 86731018 missense probably benign 0.00
R4885:Ttc41 UTSW 10 86759102 missense possibly damaging 0.76
R4898:Ttc41 UTSW 10 86776192 missense possibly damaging 0.80
R5067:Ttc41 UTSW 10 86744544 missense probably damaging 0.96
R5253:Ttc41 UTSW 10 86730942 missense probably benign 0.13
R5268:Ttc41 UTSW 10 86744478 missense possibly damaging 0.76
R5297:Ttc41 UTSW 10 86776579 missense probably benign 0.04
R5301:Ttc41 UTSW 10 86719520 missense probably benign 0.00
R5425:Ttc41 UTSW 10 86776630 missense probably damaging 0.96
R5567:Ttc41 UTSW 10 86760920 critical splice donor site probably null
R5635:Ttc41 UTSW 10 86736977 missense probably benign 0.09
R5752:Ttc41 UTSW 10 86758346 missense probably benign 0.33
R5868:Ttc41 UTSW 10 86750264 missense possibly damaging 0.70
R5948:Ttc41 UTSW 10 86713224 missense probably damaging 1.00
R6116:Ttc41 UTSW 10 86759088 critical splice acceptor site probably null
R6247:Ttc41 UTSW 10 86776663 missense probably benign 0.00
R6260:Ttc41 UTSW 10 86731159 missense probably benign 0.20
R6260:Ttc41 UTSW 10 86733707 missense probably benign 0.32
R6276:Ttc41 UTSW 10 86744449 missense probably benign 0.01
R6458:Ttc41 UTSW 10 86758270 missense possibly damaging 0.45
R7170:Ttc41 UTSW 10 86713503 missense probably benign 0.17
R7348:Ttc41 UTSW 10 86750348 nonsense probably null
R7382:Ttc41 UTSW 10 86776510 missense probably damaging 0.97
R7509:Ttc41 UTSW 10 86713432 missense probably damaging 1.00
R7689:Ttc41 UTSW 10 86759224 missense probably damaging 1.00
R7807:Ttc41 UTSW 10 86776631 missense probably benign 0.02
R7926:Ttc41 UTSW 10 86776047 missense probably benign 0.10
R7998:Ttc41 UTSW 10 86736847 missense probably benign 0.01
R8021:Ttc41 UTSW 10 86733714 missense probably benign
R8059:Ttc41 UTSW 10 86712978 missense probably benign 0.01
R8170:Ttc41 UTSW 10 86776166 missense probably damaging 1.00
R8303:Ttc41 UTSW 10 86719630 missense probably benign 0.06
R8375:Ttc41 UTSW 10 86763980 missense probably damaging 0.97
R8383:Ttc41 UTSW 10 86719526 missense probably benign 0.00
R8698:Ttc41 UTSW 10 86712977 missense probably benign 0.00
R8773:Ttc41 UTSW 10 86729815 missense probably benign 0.35
R8985:Ttc41 UTSW 10 86731092 missense possibly damaging 0.80
R8988:Ttc41 UTSW 10 86713735 missense possibly damaging 0.88
R9007:Ttc41 UTSW 10 86733761 missense probably damaging 1.00
R9137:Ttc41 UTSW 10 86776622 missense probably benign 0.22
R9236:Ttc41 UTSW 10 86776730 missense probably damaging 1.00
R9248:Ttc41 UTSW 10 86731249 missense probably benign 0.00
R9287:Ttc41 UTSW 10 86763966 missense probably benign 0.43
R9345:Ttc41 UTSW 10 86759225 missense probably damaging 0.99
R9386:Ttc41 UTSW 10 86713026 missense probably damaging 0.99
X0024:Ttc41 UTSW 10 86724250 missense probably damaging 1.00
X0064:Ttc41 UTSW 10 86729797 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATTGCATCCCTTCCACAAG -3'
(R):5'- TGGTGAAGGACTTATGGGCC -3'

Sequencing Primer
(F):5'- TGAAACTGACCAATTGCTTATAGC -3'
(R):5'- GACTTATGGGCCTTCACAGCTG -3'
Posted On 2021-08-02