Incidental Mutation 'R8902:Dnmbp'
ID 678274
Institutional Source Beutler Lab
Gene Symbol Dnmbp
Ensembl Gene ENSMUSG00000025195
Gene Name dynamin binding protein
Synonyms 2410003M15Rik, 2410003L07Rik, Tuba
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8902 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 43846821-43940191 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43901786 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 514 (L514P)
Ref Sequence ENSEMBL: ENSMUSP00000026209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026209] [ENSMUST00000212032] [ENSMUST00000212396]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000026209
AA Change: L514P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000026209
Gene: ENSMUSG00000025195
AA Change: L514P

DomainStartEndE-ValueType
SH3 5 60 6.75e-14 SMART
SH3 69 126 3.33e-4 SMART
SH3 149 204 6.85e-15 SMART
SH3 247 302 8.43e-15 SMART
low complexity region 601 619 N/A INTRINSIC
low complexity region 636 652 N/A INTRINSIC
coiled coil region 694 755 N/A INTRINSIC
low complexity region 756 764 N/A INTRINSIC
RhoGEF 787 969 4.84e-39 SMART
BAR 999 1213 6.21e-55 SMART
SH3 1291 1350 4.62e-1 SMART
low complexity region 1354 1374 N/A INTRINSIC
SH3 1519 1578 1.08e-12 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000212396
AA Change: L514P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the DBL family of guanine nucleotide exchange factors. The encoded protein has been proposed to regulate the actin cytoskeleton by specifically activating the Rho-family GTPase Cdc42. An interaction between the encoded protein and a Listeria protein has been shown to mediate Listeria infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 G T 4: 155,905,914 R819L possibly damaging Het
App A G 16: 85,079,879 V208A unknown Het
C1qtnf7 G A 5: 43,615,862 E168K probably damaging Het
Cacna1e C T 1: 154,473,886 M757I probably benign Het
Casp1 A G 9: 5,299,333 T21A probably benign Het
Ccdc92 C T 5: 124,835,641 A275T possibly damaging Het
Ccr4 T A 9: 114,496,552 probably benign Het
Cct8l1 C T 5: 25,517,910 T541I probably benign Het
Chrng G T 1: 87,210,675 R396L possibly damaging Het
Cmip A G 8: 117,377,186 T50A probably damaging Het
Ddx21 C A 10: 62,598,707 S91I probably benign Het
Echs1 A T 7: 140,110,586 M191K probably damaging Het
Eps8 A G 6: 137,512,177 S408P probably damaging Het
Fat2 T C 11: 55,310,070 E726G probably damaging Het
Fpr2 T C 17: 17,892,928 I62T probably benign Het
Gemin4 G A 11: 76,212,022 Q638* probably null Het
Glrb A T 3: 80,861,978 N147K probably damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gtf2i T C 5: 134,249,866 N637S probably benign Het
Hivep3 A G 4: 120,096,740 E751G possibly damaging Het
Ifnb1 G T 4: 88,522,310 N155K probably damaging Het
Igf2bp3 G T 6: 49,088,431 T509K probably damaging Het
Igsf10 T C 3: 59,336,212 M234V probably benign Het
Iqgap2 C T 13: 95,682,203 A682T probably benign Het
Ireb2 T G 9: 54,892,502 M409R probably benign Het
Kat6b C T 14: 21,669,561 T1327I probably benign Het
Krtap5-5 A G 7: 142,229,893 S7P unknown Het
Lelp1 A T 3: 92,135,671 C24S unknown Het
Malrd1 A T 2: 16,255,334 K2122* probably null Het
Mei1 C A 15: 82,070,011 R6S unknown Het
Meis3 T A 7: 16,177,962 I119N probably benign Het
Mmp20 T C 9: 7,639,287 V152A probably benign Het
Muc6 T A 7: 141,647,524 I797F possibly damaging Het
Myo7a C T 7: 98,092,613 E439K probably damaging Het
Neb C A 2: 52,243,210 A3439S probably damaging Het
Nfe2l1 T A 11: 96,817,794 D715V unknown Het
Obscn C A 11: 59,135,936 R147L probably benign Het
Olfr10 A T 11: 49,318,379 T278S probably benign Het
Olfr1166 A G 2: 88,124,434 S184P probably damaging Het
Olfr126 T A 17: 37,851,210 M206K probably benign Het
Olfr1507 G A 14: 52,490,553 T137I probably benign Het
Olfr164 T A 16: 19,286,633 I37F probably damaging Het
Plg T A 17: 12,410,903 F608Y probably benign Het
Plppr1 C A 4: 49,319,836 P154Q probably damaging Het
Ppp2r5e T C 12: 75,453,796 K441R probably benign Het
Prkaca T C 8: 83,977,085 S5P probably benign Het
Rbl1 T C 2: 157,199,500 K69R probably benign Het
Rbpms2 T C 9: 65,651,069 I129T probably benign Het
Serpina1c A T 12: 103,898,858 N176K probably damaging Het
Sgsm3 C T 15: 81,006,595 H117Y probably damaging Het
Sphkap A T 1: 83,278,964 C355S probably benign Het
Stpg2 T A 3: 139,298,409 V249E probably damaging Het
Syt2 T C 1: 134,747,653 V414A possibly damaging Het
Tiam2 T C 17: 3,477,196 I1050T probably benign Het
Tmem131 A T 1: 36,808,965 I1134N probably damaging Het
Ttc23 A G 7: 67,693,013 E293G Het
Ttc41 C A 10: 86,713,001 R20S probably benign Het
Ttn C T 2: 76,740,789 V26587M probably damaging Het
Ugt2a2 T C 5: 87,460,411 K523R possibly damaging Het
Unc13c A G 9: 73,749,548 C1124R probably damaging Het
Ush2a T A 1: 188,443,084 N1126K probably damaging Het
Usp36 A T 11: 118,275,014 L326Q probably damaging Het
Zfp568 T C 7: 30,013,882 M120T probably benign Het
Zfp944 T C 17: 22,339,780 D162G probably benign Het
Other mutations in Dnmbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Dnmbp APN 19 43902479 missense probably damaging 1.00
IGL01301:Dnmbp APN 19 43902354 missense probably benign 0.04
IGL01443:Dnmbp APN 19 43902870 missense probably damaging 1.00
IGL01569:Dnmbp APN 19 43874856 missense probably benign 0.14
IGL01818:Dnmbp APN 19 43901165 missense probably damaging 1.00
IGL01989:Dnmbp APN 19 43867555 missense probably damaging 1.00
IGL02111:Dnmbp APN 19 43867555 missense probably damaging 1.00
IGL02666:Dnmbp APN 19 43854127 splice site probably benign
IGL02736:Dnmbp APN 19 43849770 splice site probably benign
ANU18:Dnmbp UTSW 19 43902354 missense probably benign 0.04
R0013:Dnmbp UTSW 19 43902231 missense probably benign 0.00
R0013:Dnmbp UTSW 19 43902231 missense probably benign 0.00
R0032:Dnmbp UTSW 19 43902719 missense probably damaging 1.00
R0032:Dnmbp UTSW 19 43902719 missense probably damaging 1.00
R0101:Dnmbp UTSW 19 43874160 missense possibly damaging 0.94
R0129:Dnmbp UTSW 19 43850027 missense probably benign 0.03
R0288:Dnmbp UTSW 19 43902459 missense possibly damaging 0.77
R0322:Dnmbp UTSW 19 43854846 missense probably damaging 1.00
R0426:Dnmbp UTSW 19 43852436 splice site probably benign
R0432:Dnmbp UTSW 19 43854857 nonsense probably null
R0497:Dnmbp UTSW 19 43856640 splice site probably benign
R1306:Dnmbp UTSW 19 43901779 missense probably benign 0.00
R1765:Dnmbp UTSW 19 43902140 missense possibly damaging 0.61
R1800:Dnmbp UTSW 19 43901720 missense probably benign 0.00
R1846:Dnmbp UTSW 19 43902747 missense probably damaging 1.00
R1916:Dnmbp UTSW 19 43901568 missense possibly damaging 0.85
R2001:Dnmbp UTSW 19 43850173 missense possibly damaging 0.76
R2131:Dnmbp UTSW 19 43854311 missense probably damaging 1.00
R2156:Dnmbp UTSW 19 43901907 missense possibly damaging 0.95
R2238:Dnmbp UTSW 19 43868864 missense possibly damaging 0.90
R2372:Dnmbp UTSW 19 43902320 missense probably benign 0.01
R4817:Dnmbp UTSW 19 43849972 missense probably benign 0.05
R5093:Dnmbp UTSW 19 43849876 missense probably damaging 0.98
R5249:Dnmbp UTSW 19 43902440 missense probably damaging 0.98
R5970:Dnmbp UTSW 19 43854171 missense probably benign 0.28
R6168:Dnmbp UTSW 19 43850240 missense probably damaging 1.00
R6189:Dnmbp UTSW 19 43890309 missense probably benign 0.00
R6189:Dnmbp UTSW 19 43901511 missense probably benign 0.05
R6239:Dnmbp UTSW 19 43848185 missense probably benign 0.11
R6256:Dnmbp UTSW 19 43852281 missense probably damaging 1.00
R6461:Dnmbp UTSW 19 43867525 critical splice donor site probably null
R6599:Dnmbp UTSW 19 43856586 missense probably damaging 0.96
R6704:Dnmbp UTSW 19 43901213 missense probably damaging 1.00
R7350:Dnmbp UTSW 19 43901505 missense probably damaging 1.00
R7355:Dnmbp UTSW 19 43901741 missense probably benign
R7409:Dnmbp UTSW 19 43890557 missense unknown
R7548:Dnmbp UTSW 19 43889399 missense probably benign 0.40
R7755:Dnmbp UTSW 19 43850086 missense probably benign
R7814:Dnmbp UTSW 19 43854176 missense probably benign 0.05
R7954:Dnmbp UTSW 19 43902303 missense probably benign
R7955:Dnmbp UTSW 19 43902323 missense probably benign 0.01
R8282:Dnmbp UTSW 19 43890566 missense unknown
R8385:Dnmbp UTSW 19 43889651 missense probably benign 0.01
R8696:Dnmbp UTSW 19 43874223 missense probably damaging 1.00
R8738:Dnmbp UTSW 19 43912238 missense probably damaging 0.98
R8819:Dnmbp UTSW 19 43901415 missense probably benign 0.43
R8824:Dnmbp UTSW 19 43849837 missense probably benign
R8906:Dnmbp UTSW 19 43890242 missense probably benign 0.01
R8977:Dnmbp UTSW 19 43852312 missense probably damaging 1.00
R9628:Dnmbp UTSW 19 43870207 missense probably damaging 0.99
R9635:Dnmbp UTSW 19 43867535 missense probably benign 0.39
R9771:Dnmbp UTSW 19 43866592 missense probably damaging 0.96
Z1088:Dnmbp UTSW 19 43874984 missense probably benign 0.01
Z1088:Dnmbp UTSW 19 43902122 missense probably benign 0.00
Z1176:Dnmbp UTSW 19 43866688 missense probably damaging 0.99
Z1176:Dnmbp UTSW 19 43889367 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CGTACAATCGTCTCTGGCTC -3'
(R):5'- CTGAGCTTGTCCCACTAGAAGC -3'

Sequencing Primer
(F):5'- AATCGTCTCTGGCTCTGTGCTG -3'
(R):5'- TTGTCCCACTAGAAGCCAGGAC -3'
Posted On 2021-08-02