Incidental Mutation 'R8903:Magel2'
ID 678306
Institutional Source Beutler Lab
Gene Symbol Magel2
Ensembl Gene ENSMUSG00000056972
Gene Name melanoma antigen, family L, 2
Synonyms nM15, ns7, NDNL1, Mage-l2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8903 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 62377010-62381640 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 62379693 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 782 (A782S)
Ref Sequence ENSEMBL: ENSMUSP00000079265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080403]
AlphaFold Q9QZ04
Predicted Effect unknown
Transcript: ENSMUST00000080403
AA Change: A782S
SMART Domains Protein: ENSMUSP00000079265
Gene: ENSMUSG00000056972
AA Change: A782S

DomainStartEndE-ValueType
low complexity region 30 49 N/A INTRINSIC
low complexity region 51 84 N/A INTRINSIC
internal_repeat_1 85 131 2.45e-10 PROSPERO
low complexity region 134 205 N/A INTRINSIC
internal_repeat_1 222 298 2.45e-10 PROSPERO
internal_repeat_2 289 332 6.32e-5 PROSPERO
low complexity region 347 363 N/A INTRINSIC
low complexity region 467 492 N/A INTRINSIC
internal_repeat_2 494 535 6.32e-5 PROSPERO
low complexity region 560 648 N/A INTRINSIC
low complexity region 675 686 N/A INTRINSIC
low complexity region 761 785 N/A INTRINSIC
low complexity region 903 920 N/A INTRINSIC
MAGE 1059 1229 6.82e-65 SMART
low complexity region 1262 1284 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Prader-Willi syndrome (PWS) is caused by the loss of expression of imprinted genes in chromosome 15q11-q13 region. Affected individuals exhibit neonatal hypotonia, developmental delay, and childhood-onset obesity. Necdin (NDN), a gene involved in the terminal differentiation of neurons, localizes to this region of the genome and has been implicated as one of the genes responsible for the etiology of PWS. This gene is structurally similar to NDN, is also localized to the PWS chromosomal region, and is paternally imprinted, suggesting a possible role for it in PWS. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice heterozygous for a null allele that is inherited paternally exhibit some postnatal lethality, reduced male fertility, abnormal circadian rhythm, and hypoactivity. Mice heterozygous for another paternal knock-out allele exhibit 50% neonatal lethalityassociated with weak suckling activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110079O15Rik C T 1: 87,475,104 T52I probably damaging Het
Abca14 T C 7: 120,216,303 F258S probably damaging Het
Abca3 A G 17: 24,383,985 Y518C probably damaging Het
Ank2 A T 3: 127,046,782 N274K probably damaging Het
Ankrd31 C T 13: 96,832,821 L989F probably damaging Het
Ano6 A G 15: 95,927,582 R354G probably benign Het
Ano8 T C 8: 71,482,190 probably null Het
Arfgef1 T C 1: 10,141,613 Y1735C probably damaging Het
B3gnt8 G A 7: 25,629,234 G363D probably benign Het
Calcrl T C 2: 84,373,385 probably null Het
Cc2d2b A T 19: 40,809,282 D782V unknown Het
Ccdc162 A G 10: 41,655,444 probably null Het
Cdkal1 A T 13: 29,625,935 *219R probably null Het
Clcnkb A T 4: 141,407,849 V526D possibly damaging Het
Cnbp A T 6: 87,844,092 C162S probably damaging Het
Coq2 A G 5: 100,663,790 probably benign Het
D6Wsu163e T A 6: 126,954,815 L270Q probably damaging Het
Dnhd1 C T 7: 105,713,648 Q3806* probably null Het
Eepd1 T C 9: 25,483,222 F261L probably benign Het
Fam45a C T 19: 60,834,985 Q353* probably null Het
Fes C T 7: 80,386,811 probably benign Het
Fsip2 T A 2: 82,977,337 D1333E possibly damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm5113 T C 7: 30,178,867 F127L probably benign Het
Grk3 A G 5: 112,918,831 S596P possibly damaging Het
Gsk3a A G 7: 25,237,389 V91A possibly damaging Het
Gss T C 2: 155,578,359 K141E probably damaging Het
Il1rl2 A T 1: 40,327,370 probably null Het
Kcnmb1 A G 11: 33,964,825 Y42C probably damaging Het
Krtap16-1 A T 11: 99,986,344 I78N probably damaging Het
Lrp2 C T 2: 69,549,038 S110N possibly damaging Het
Lrrfip1 T A 1: 91,085,059 probably benign Het
Map1b C A 13: 99,432,509 E1235* probably null Het
Mcpt1 A C 14: 56,020,063 H222P probably benign Het
Met T A 6: 17,549,138 N996K probably benign Het
Mia C A 7: 27,180,805 Q52H probably damaging Het
Mia T A 7: 27,180,806 Q52L possibly damaging Het
Myh7 T A 14: 54,992,771 K35* probably null Het
Myt1l T A 12: 29,811,469 D83E unknown Het
Nbl1 A G 4: 139,083,550 V111A probably damaging Het
Nid1 T A 13: 13,463,930 V145D probably benign Het
Nif3l1 C T 1: 58,447,494 probably benign Het
Npnt T C 3: 132,886,003 Y500C probably damaging Het
Nubpl T A 12: 52,097,893 probably null Het
Nxpe4 T A 9: 48,398,950 D504E probably damaging Het
Obsl1 A G 1: 75,487,273 V1696A possibly damaging Het
Olfr283 A T 15: 98,378,594 I172N probably damaging Het
Olfr679 A T 7: 105,086,122 R135S possibly damaging Het
P2rx1 A T 11: 73,009,995 H224L probably benign Het
Pald1 A T 10: 61,347,036 probably null Het
Pard6g C T 18: 80,117,196 R175* probably null Het
Pisd A G 5: 32,738,411 I271T probably benign Het
Prrt3 T C 6: 113,495,835 S459G probably damaging Het
Psd3 A T 8: 67,713,293 C328S unknown Het
Psme1 A G 14: 55,580,396 E120G Het
Pum3 A T 19: 27,420,057 M306K possibly damaging Het
Pxdn T C 12: 29,990,993 F423L probably benign Het
Rac3 A G 11: 120,723,245 D118G probably damaging Het
Rnf14 A G 18: 38,313,214 K357E probably benign Het
Rpl23a T C 11: 78,182,894 I40V probably benign Het
Slc5a5 A T 8: 70,892,583 S27T probably damaging Het
Slc7a14 A T 3: 31,223,446 L670Q probably damaging Het
Sst T A 16: 23,889,749 K111* probably null Het
Stxbp4 A G 11: 90,535,441 S514P unknown Het
Susd1 T A 4: 59,390,576 T300S probably benign Het
Tecpr1 C T 5: 144,214,027 probably benign Het
Tmem185b C T 1: 119,526,468 probably benign Het
Tor2a T A 2: 32,761,687 F305I probably damaging Het
Ttk T A 9: 83,868,060 D689E probably damaging Het
Usp25 A G 16: 77,081,533 D615G probably damaging Het
Vmn1r209 A G 13: 22,806,514 V2A probably benign Het
Vmn2r80 A C 10: 79,182,094 E551A probably damaging Het
Wac G T 18: 7,926,104 E636* probably null Het
Wdr53 T A 16: 32,252,312 D158E probably damaging Het
Zbtb7c T C 18: 76,137,081 V80A probably damaging Het
Zcchc11 A T 4: 108,479,211 D44V probably damaging Het
Other mutations in Magel2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Magel2 APN 7 62379322 missense unknown
IGL01391:Magel2 APN 7 62380884 missense unknown
IGL01876:Magel2 APN 7 62378827 missense possibly damaging 0.68
IGL02613:Magel2 APN 7 62380198 missense unknown
IGL02617:Magel2 APN 7 62380198 missense unknown
IGL03256:Magel2 APN 7 62380414 missense unknown
IGL03382:Magel2 APN 7 62378713 missense probably benign 0.00
astroclast2 UTSW 7 62380159 missense unknown
IGL02837:Magel2 UTSW 7 62378260 missense possibly damaging 0.93
R0398:Magel2 UTSW 7 62380551 nonsense probably null
R0463:Magel2 UTSW 7 62378030 missense possibly damaging 0.53
R1033:Magel2 UTSW 7 62380050 missense unknown
R1271:Magel2 UTSW 7 62381014 missense unknown
R1518:Magel2 UTSW 7 62380440 missense unknown
R1539:Magel2 UTSW 7 62378809 missense possibly damaging 0.91
R1682:Magel2 UTSW 7 62380235 missense unknown
R1686:Magel2 UTSW 7 62378240 missense possibly damaging 0.53
R1782:Magel2 UTSW 7 62380857 nonsense probably null
R1785:Magel2 UTSW 7 62377738 missense unknown
R1786:Magel2 UTSW 7 62377738 missense unknown
R1950:Magel2 UTSW 7 62378415 missense possibly damaging 0.48
R2001:Magel2 UTSW 7 62379096 missense unknown
R2002:Magel2 UTSW 7 62379096 missense unknown
R2018:Magel2 UTSW 7 62379096 missense unknown
R2019:Magel2 UTSW 7 62379096 missense unknown
R2029:Magel2 UTSW 7 62380594 missense unknown
R2070:Magel2 UTSW 7 62379096 missense unknown
R2131:Magel2 UTSW 7 62377738 missense unknown
R2132:Magel2 UTSW 7 62377738 missense unknown
R2133:Magel2 UTSW 7 62377738 missense unknown
R2134:Magel2 UTSW 7 62379096 missense unknown
R2155:Magel2 UTSW 7 62380792 missense unknown
R4294:Magel2 UTSW 7 62378767 missense possibly damaging 0.86
R4591:Magel2 UTSW 7 62381089 missense unknown
R4621:Magel2 UTSW 7 62377738 missense unknown
R4816:Magel2 UTSW 7 62381092 missense unknown
R4931:Magel2 UTSW 7 62380624 missense unknown
R5031:Magel2 UTSW 7 62380104 missense unknown
R5034:Magel2 UTSW 7 62379868 missense unknown
R5042:Magel2 UTSW 7 62379606 missense unknown
R5600:Magel2 UTSW 7 62379766 missense unknown
R5769:Magel2 UTSW 7 62378113 missense probably benign 0.02
R5980:Magel2 UTSW 7 62380596 missense unknown
R5987:Magel2 UTSW 7 62378767 missense probably benign 0.33
R6187:Magel2 UTSW 7 62377641 missense unknown
R6267:Magel2 UTSW 7 62378679 missense probably damaging 0.98
R6270:Magel2 UTSW 7 62380658 nonsense probably null
R6316:Magel2 UTSW 7 62378719 missense possibly damaging 0.68
R6444:Magel2 UTSW 7 62379999 missense unknown
R6452:Magel2 UTSW 7 62380384 missense unknown
R6797:Magel2 UTSW 7 62380159 missense unknown
R6917:Magel2 UTSW 7 62377844 small deletion probably benign
R7011:Magel2 UTSW 7 62378533 missense possibly damaging 0.92
R7025:Magel2 UTSW 7 62379787 missense unknown
R7335:Magel2 UTSW 7 62380776 missense unknown
R7353:Magel2 UTSW 7 62379331 missense unknown
R7413:Magel2 UTSW 7 62377844 small deletion probably benign
R7570:Magel2 UTSW 7 62378910 missense possibly damaging 0.53
R7714:Magel2 UTSW 7 62378382 missense probably benign 0.08
R7836:Magel2 UTSW 7 62378368 missense possibly damaging 0.73
R8289:Magel2 UTSW 7 62379127 missense unknown
R8717:Magel2 UTSW 7 62377672 missense unknown
R8911:Magel2 UTSW 7 62379789 missense unknown
R8971:Magel2 UTSW 7 62380251 missense unknown
R9096:Magel2 UTSW 7 62380549 missense unknown
R9264:Magel2 UTSW 7 62378596 missense possibly damaging 0.95
RF022:Magel2 UTSW 7 62380093 missense unknown
Z1088:Magel2 UTSW 7 62378977 missense possibly damaging 0.53
Z1177:Magel2 UTSW 7 62379607 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGCACTGCAAACTCAGCTG -3'
(R):5'- CAGTGACTTTGGGCTCTCTG -3'

Sequencing Primer
(F):5'- GGCTTGCAGGCAGAACTG -3'
(R):5'- CGGCAGATGGACCTCTAAAG -3'
Posted On 2021-08-02