Incidental Mutation 'R8903:Abca14'
ID 678309
Institutional Source Beutler Lab
Gene Symbol Abca14
Ensembl Gene ENSMUSG00000062017
Gene Name ATP-binding cassette, sub-family A member 14
Synonyms 1700110B15Rik, 4930539G24Rik
MMRRC Submission 068760-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8903 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 119803184-119924575 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 119815526 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 258 (F258S)
Ref Sequence ENSEMBL: ENSMUSP00000081690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084640]
AlphaFold E9Q8F8
Predicted Effect probably damaging
Transcript: ENSMUST00000084640
AA Change: F258S

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081690
Gene: ENSMUSG00000062017
AA Change: F258S

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 463 5.7e-23 PFAM
AAA 548 729 1.59e-10 SMART
Pfam:ABC2_membrane_3 902 1296 1.2e-36 PFAM
AAA 1384 1568 1.33e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 97% (74/76)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A G 17: 24,602,959 (GRCm39) Y518C probably damaging Het
Ank2 A T 3: 126,840,431 (GRCm39) N274K probably damaging Het
Ankrd31 C T 13: 96,969,329 (GRCm39) L989F probably damaging Het
Ano6 A G 15: 95,825,463 (GRCm39) R354G probably benign Het
Ano8 T C 8: 71,934,834 (GRCm39) probably null Het
Arfgef1 T C 1: 10,211,838 (GRCm39) Y1735C probably damaging Het
B3gnt8 G A 7: 25,328,659 (GRCm39) G363D probably benign Het
Calcrl T C 2: 84,203,729 (GRCm39) probably null Het
Cc2d2b A T 19: 40,797,726 (GRCm39) D782V unknown Het
Ccdc162 A G 10: 41,531,440 (GRCm39) probably null Het
Cdkal1 A T 13: 29,809,918 (GRCm39) *219R probably null Het
Clcnkb A T 4: 141,135,160 (GRCm39) V526D possibly damaging Het
Cnbp A T 6: 87,821,074 (GRCm39) C162S probably damaging Het
Coq2 A G 5: 100,811,656 (GRCm39) probably benign Het
D6Wsu163e T A 6: 126,931,778 (GRCm39) L270Q probably damaging Het
Dennd10 C T 19: 60,823,423 (GRCm39) Q353* probably null Het
Dnhd1 C T 7: 105,362,855 (GRCm39) Q3806* probably null Het
Eepd1 T C 9: 25,394,518 (GRCm39) F261L probably benign Het
Fes C T 7: 80,036,559 (GRCm39) probably benign Het
Fsip2 T A 2: 82,807,681 (GRCm39) D1333E possibly damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,497,361 (GRCm39) probably null Het
Gm5113 T C 7: 29,878,292 (GRCm39) F127L probably benign Het
Grk3 A G 5: 113,066,697 (GRCm39) S596P possibly damaging Het
Gsk3a A G 7: 24,936,814 (GRCm39) V91A possibly damaging Het
Gss T C 2: 155,420,279 (GRCm39) K141E probably damaging Het
Il1rl2 A T 1: 40,366,530 (GRCm39) probably null Het
Kcnmb1 A G 11: 33,914,825 (GRCm39) Y42C probably damaging Het
Krtap16-1 A T 11: 99,877,170 (GRCm39) I78N probably damaging Het
Lrp2 C T 2: 69,379,382 (GRCm39) S110N possibly damaging Het
Lrrfip1 T A 1: 91,012,781 (GRCm39) probably benign Het
Magel2 G T 7: 62,029,441 (GRCm39) A782S unknown Het
Map1b C A 13: 99,569,017 (GRCm39) E1235* probably null Het
Mcpt1 A C 14: 56,257,520 (GRCm39) H222P probably benign Het
Met T A 6: 17,549,137 (GRCm39) N996K probably benign Het
Mia C A 7: 26,880,230 (GRCm39) Q52H probably damaging Het
Mia T A 7: 26,880,231 (GRCm39) Q52L possibly damaging Het
Myh7 T A 14: 55,230,228 (GRCm39) K35* probably null Het
Myt1l T A 12: 29,861,468 (GRCm39) D83E unknown Het
Nbl1 A G 4: 138,810,861 (GRCm39) V111A probably damaging Het
Nid1 T A 13: 13,638,515 (GRCm39) V145D probably benign Het
Nif3l1 C T 1: 58,486,653 (GRCm39) probably benign Het
Npnt T C 3: 132,591,764 (GRCm39) Y500C probably damaging Het
Nubpl T A 12: 52,144,676 (GRCm39) probably null Het
Nxpe4 T A 9: 48,310,250 (GRCm39) D504E probably damaging Het
Obsl1 A G 1: 75,463,917 (GRCm39) V1696A possibly damaging Het
Or56a3 A T 7: 104,735,329 (GRCm39) R135S possibly damaging Het
Or8s2 A T 15: 98,276,475 (GRCm39) I172N probably damaging Het
P2rx1 A T 11: 72,900,821 (GRCm39) H224L probably benign Het
Pald1 A T 10: 61,182,815 (GRCm39) probably null Het
Pard6g C T 18: 80,160,411 (GRCm39) R175* probably null Het
Pisd A G 5: 32,895,755 (GRCm39) I271T probably benign Het
Prrt3 T C 6: 113,472,796 (GRCm39) S459G probably damaging Het
Psd3 A T 8: 68,165,945 (GRCm39) C328S unknown Het
Psme1 A G 14: 55,817,853 (GRCm39) E120G Het
Pum3 A T 19: 27,397,457 (GRCm39) M306K possibly damaging Het
Pxdn T C 12: 30,040,992 (GRCm39) F423L probably benign Het
Rac3 A G 11: 120,614,071 (GRCm39) D118G probably damaging Het
Rnf14 A G 18: 38,446,267 (GRCm39) K357E probably benign Het
Rpl23a T C 11: 78,073,720 (GRCm39) I40V probably benign Het
Slc5a5 A T 8: 71,345,227 (GRCm39) S27T probably damaging Het
Slc7a14 A T 3: 31,277,595 (GRCm39) L670Q probably damaging Het
Snorc C T 1: 87,402,826 (GRCm39) T52I probably damaging Het
Sst T A 16: 23,708,499 (GRCm39) K111* probably null Het
Stxbp4 A G 11: 90,426,267 (GRCm39) S514P unknown Het
Susd1 T A 4: 59,390,576 (GRCm39) T300S probably benign Het
Tecpr1 C T 5: 144,150,845 (GRCm39) probably benign Het
Tmem185b C T 1: 119,454,198 (GRCm39) probably benign Het
Tor2a T A 2: 32,651,699 (GRCm39) F305I probably damaging Het
Ttk T A 9: 83,750,113 (GRCm39) D689E probably damaging Het
Tut4 A T 4: 108,336,408 (GRCm39) D44V probably damaging Het
Usp25 A G 16: 76,878,421 (GRCm39) D615G probably damaging Het
Vmn1r209 A G 13: 22,990,684 (GRCm39) V2A probably benign Het
Vmn2r80 A C 10: 79,017,928 (GRCm39) E551A probably damaging Het
Wac G T 18: 7,926,104 (GRCm39) E636* probably null Het
Wdr53 T A 16: 32,071,130 (GRCm39) D158E probably damaging Het
Zbtb7c T C 18: 76,270,152 (GRCm39) V80A probably damaging Het
Other mutations in Abca14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Abca14 APN 7 119,846,076 (GRCm39) missense probably damaging 1.00
IGL00800:Abca14 APN 7 119,854,613 (GRCm39) missense probably benign 0.01
IGL00845:Abca14 APN 7 119,823,174 (GRCm39) splice site probably benign
IGL00897:Abca14 APN 7 119,815,348 (GRCm39) splice site probably benign
IGL01524:Abca14 APN 7 119,852,644 (GRCm39) missense possibly damaging 0.57
IGL01747:Abca14 APN 7 119,877,310 (GRCm39) missense probably benign 0.00
IGL02214:Abca14 APN 7 119,893,398 (GRCm39) missense probably benign 0.09
IGL02215:Abca14 APN 7 119,852,612 (GRCm39) missense probably benign 0.00
IGL02253:Abca14 APN 7 119,807,182 (GRCm39) missense probably benign 0.29
IGL02302:Abca14 APN 7 119,917,968 (GRCm39) splice site probably benign
IGL03391:Abca14 APN 7 119,846,107 (GRCm39) missense probably damaging 1.00
F6893:Abca14 UTSW 7 119,924,261 (GRCm39) missense probably damaging 0.98
R0109:Abca14 UTSW 7 119,917,985 (GRCm39) nonsense probably null
R0109:Abca14 UTSW 7 119,917,985 (GRCm39) nonsense probably null
R0265:Abca14 UTSW 7 119,822,850 (GRCm39) missense probably benign 0.03
R0326:Abca14 UTSW 7 119,823,642 (GRCm39) missense probably damaging 1.00
R0380:Abca14 UTSW 7 119,877,703 (GRCm39) missense probably benign 0.03
R0418:Abca14 UTSW 7 119,806,657 (GRCm39) missense probably damaging 1.00
R0539:Abca14 UTSW 7 119,807,020 (GRCm39) missense probably damaging 1.00
R0574:Abca14 UTSW 7 119,823,720 (GRCm39) missense probably damaging 0.96
R0611:Abca14 UTSW 7 119,851,479 (GRCm39) missense possibly damaging 0.63
R0783:Abca14 UTSW 7 119,893,380 (GRCm39) missense probably damaging 1.00
R0785:Abca14 UTSW 7 119,893,380 (GRCm39) missense probably damaging 1.00
R0863:Abca14 UTSW 7 119,815,453 (GRCm39) missense probably benign 0.03
R1034:Abca14 UTSW 7 119,815,370 (GRCm39) missense probably damaging 1.00
R1056:Abca14 UTSW 7 119,924,295 (GRCm39) missense probably damaging 1.00
R1072:Abca14 UTSW 7 119,811,992 (GRCm39) missense probably benign
R1244:Abca14 UTSW 7 119,815,561 (GRCm39) missense probably benign 0.06
R1255:Abca14 UTSW 7 119,807,016 (GRCm39) missense probably damaging 0.97
R1271:Abca14 UTSW 7 119,924,340 (GRCm39) missense probably damaging 1.00
R1325:Abca14 UTSW 7 119,846,545 (GRCm39) missense probably benign 0.32
R1457:Abca14 UTSW 7 119,888,683 (GRCm39) missense probably benign 0.00
R1467:Abca14 UTSW 7 119,815,405 (GRCm39) missense possibly damaging 0.80
R1467:Abca14 UTSW 7 119,815,405 (GRCm39) missense possibly damaging 0.80
R1494:Abca14 UTSW 7 119,815,524 (GRCm39) missense probably benign 0.00
R1551:Abca14 UTSW 7 119,918,101 (GRCm39) missense probably benign 0.10
R1607:Abca14 UTSW 7 119,850,514 (GRCm39) missense probably damaging 1.00
R1739:Abca14 UTSW 7 119,877,529 (GRCm39) missense probably benign 0.04
R1856:Abca14 UTSW 7 119,877,404 (GRCm39) missense probably damaging 1.00
R1875:Abca14 UTSW 7 119,847,190 (GRCm39) missense possibly damaging 0.78
R1892:Abca14 UTSW 7 119,815,561 (GRCm39) missense probably benign 0.06
R1898:Abca14 UTSW 7 119,850,392 (GRCm39) missense probably damaging 1.00
R1958:Abca14 UTSW 7 119,924,382 (GRCm39) missense probably damaging 0.98
R2018:Abca14 UTSW 7 119,815,408 (GRCm39) missense probably benign 0.00
R2039:Abca14 UTSW 7 119,911,487 (GRCm39) missense probably damaging 0.98
R2060:Abca14 UTSW 7 119,826,741 (GRCm39) nonsense probably null
R2202:Abca14 UTSW 7 119,888,764 (GRCm39) missense probably benign 0.17
R2205:Abca14 UTSW 7 119,846,503 (GRCm39) missense probably damaging 0.98
R2360:Abca14 UTSW 7 119,850,431 (GRCm39) missense probably benign 0.00
R2401:Abca14 UTSW 7 119,882,312 (GRCm39) missense probably damaging 1.00
R2426:Abca14 UTSW 7 119,882,446 (GRCm39) missense probably benign 0.04
R3433:Abca14 UTSW 7 119,893,455 (GRCm39) missense probably damaging 0.97
R4598:Abca14 UTSW 7 119,854,626 (GRCm39) missense probably benign 0.11
R4599:Abca14 UTSW 7 119,854,626 (GRCm39) missense probably benign 0.11
R4700:Abca14 UTSW 7 119,911,928 (GRCm39) critical splice donor site probably null
R4751:Abca14 UTSW 7 119,911,400 (GRCm39) missense probably benign 0.01
R4826:Abca14 UTSW 7 119,815,470 (GRCm39) missense probably damaging 1.00
R4828:Abca14 UTSW 7 119,815,470 (GRCm39) missense probably damaging 1.00
R4837:Abca14 UTSW 7 119,846,203 (GRCm39) missense probably benign
R4881:Abca14 UTSW 7 119,877,472 (GRCm39) missense possibly damaging 0.49
R4895:Abca14 UTSW 7 119,846,572 (GRCm39) critical splice donor site probably null
R4928:Abca14 UTSW 7 119,923,803 (GRCm39) missense possibly damaging 0.90
R4990:Abca14 UTSW 7 119,911,388 (GRCm39) missense probably benign 0.00
R5027:Abca14 UTSW 7 119,911,505 (GRCm39) missense probably benign 0.05
R5091:Abca14 UTSW 7 119,851,497 (GRCm39) missense probably damaging 1.00
R5158:Abca14 UTSW 7 119,852,652 (GRCm39) missense probably benign
R5209:Abca14 UTSW 7 119,832,130 (GRCm39) missense probably benign 0.01
R5333:Abca14 UTSW 7 119,888,769 (GRCm39) nonsense probably null
R5424:Abca14 UTSW 7 119,810,777 (GRCm39) missense probably benign 0.01
R5488:Abca14 UTSW 7 119,851,473 (GRCm39) missense probably damaging 0.98
R5489:Abca14 UTSW 7 119,851,473 (GRCm39) missense probably damaging 0.98
R5716:Abca14 UTSW 7 119,846,217 (GRCm39) critical splice donor site probably null
R6450:Abca14 UTSW 7 119,815,449 (GRCm39) missense probably benign 0.17
R6477:Abca14 UTSW 7 119,924,325 (GRCm39) missense probably benign 0.44
R6652:Abca14 UTSW 7 119,846,164 (GRCm39) missense probably damaging 1.00
R6782:Abca14 UTSW 7 119,847,308 (GRCm39) missense probably damaging 1.00
R6874:Abca14 UTSW 7 119,851,428 (GRCm39) missense possibly damaging 0.71
R6965:Abca14 UTSW 7 119,882,452 (GRCm39) nonsense probably null
R7142:Abca14 UTSW 7 119,850,406 (GRCm39) missense possibly damaging 0.89
R7146:Abca14 UTSW 7 119,854,520 (GRCm39) missense probably benign 0.15
R7202:Abca14 UTSW 7 119,917,236 (GRCm39) missense probably damaging 1.00
R7220:Abca14 UTSW 7 119,826,667 (GRCm39) missense possibly damaging 0.45
R7241:Abca14 UTSW 7 119,846,184 (GRCm39) missense probably damaging 1.00
R7291:Abca14 UTSW 7 119,888,832 (GRCm39) nonsense probably null
R7296:Abca14 UTSW 7 119,877,534 (GRCm39) missense probably benign
R7298:Abca14 UTSW 7 119,807,106 (GRCm39) missense probably benign 0.00
R7315:Abca14 UTSW 7 119,893,341 (GRCm39) missense probably benign 0.00
R7776:Abca14 UTSW 7 119,832,214 (GRCm39) critical splice donor site probably null
R7820:Abca14 UTSW 7 119,811,944 (GRCm39) missense probably benign 0.42
R7873:Abca14 UTSW 7 119,888,792 (GRCm39) missense probably benign 0.17
R8215:Abca14 UTSW 7 119,893,425 (GRCm39) missense probably benign
R8332:Abca14 UTSW 7 119,815,436 (GRCm39) missense probably benign
R8419:Abca14 UTSW 7 119,815,489 (GRCm39) missense probably benign 0.08
R8444:Abca14 UTSW 7 119,918,133 (GRCm39) missense probably damaging 1.00
R8818:Abca14 UTSW 7 119,815,524 (GRCm39) missense probably benign 0.00
R8834:Abca14 UTSW 7 119,877,372 (GRCm39) missense probably benign 0.02
R8845:Abca14 UTSW 7 119,846,428 (GRCm39) missense probably benign 0.00
R8889:Abca14 UTSW 7 119,815,606 (GRCm39) missense probably damaging 1.00
R8892:Abca14 UTSW 7 119,815,606 (GRCm39) missense probably damaging 1.00
R8894:Abca14 UTSW 7 119,847,368 (GRCm39) missense probably damaging 1.00
R8950:Abca14 UTSW 7 119,823,595 (GRCm39) missense possibly damaging 0.92
R8950:Abca14 UTSW 7 119,823,644 (GRCm39) nonsense probably null
R9018:Abca14 UTSW 7 119,918,532 (GRCm39) missense probably damaging 0.98
R9018:Abca14 UTSW 7 119,888,763 (GRCm39) missense probably benign 0.01
R9110:Abca14 UTSW 7 119,831,615 (GRCm39) intron probably benign
R9254:Abca14 UTSW 7 119,807,202 (GRCm39) nonsense probably null
R9376:Abca14 UTSW 7 119,893,438 (GRCm39) missense probably damaging 1.00
R9378:Abca14 UTSW 7 119,807,191 (GRCm39) missense possibly damaging 0.64
R9379:Abca14 UTSW 7 119,807,202 (GRCm39) nonsense probably null
R9388:Abca14 UTSW 7 119,882,261 (GRCm39) missense probably benign 0.01
R9445:Abca14 UTSW 7 119,877,691 (GRCm39) missense probably benign 0.05
R9522:Abca14 UTSW 7 119,847,368 (GRCm39) missense probably null 0.98
R9577:Abca14 UTSW 7 119,810,768 (GRCm39) missense probably benign 0.27
R9627:Abca14 UTSW 7 119,854,530 (GRCm39) missense probably benign 0.00
R9639:Abca14 UTSW 7 119,893,345 (GRCm39) missense probably benign 0.01
R9660:Abca14 UTSW 7 119,851,478 (GRCm39) missense probably benign 0.00
R9696:Abca14 UTSW 7 119,888,734 (GRCm39) missense possibly damaging 0.59
R9709:Abca14 UTSW 7 119,888,739 (GRCm39) nonsense probably null
R9780:Abca14 UTSW 7 119,911,447 (GRCm39) missense probably benign 0.00
Z1088:Abca14 UTSW 7 119,815,358 (GRCm39) missense probably benign 0.14
Z1176:Abca14 UTSW 7 119,846,146 (GRCm39) missense probably damaging 1.00
Z1177:Abca14 UTSW 7 119,917,210 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTATCCTGAACTTGACAGTCTCTG -3'
(R):5'- TGATTGCATGCAGCTCCCAC -3'

Sequencing Primer
(F):5'- CCTGAACTTGACAGTCTCTGGTTTTG -3'
(R):5'- CCCACAGGATGTCTATTTAGCAGAG -3'
Posted On 2021-08-02