Incidental Mutation 'R8903:Pxdn'
ID678326
Institutional Source Beutler Lab
Gene Symbol Pxdn
Ensembl Gene ENSMUSG00000020674
Gene Nameperoxidasin
SynonymsVPO1, 2310075M15Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.617) question?
Stock #R8903 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location29937608-30017658 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29990993 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 423 (F423L)
Ref Sequence ENSEMBL: ENSMUSP00000113703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118321] [ENSMUST00000122328] [ENSMUST00000220271]
Predicted Effect probably benign
Transcript: ENSMUST00000118321
SMART Domains Protein: ENSMUSP00000113477
Gene: ENSMUSG00000020674

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LRRNT 32 63 2.52e-1 SMART
LRR 62 81 4.09e1 SMART
LRR_TYP 82 105 3.69e-4 SMART
LRR_TYP 106 129 1.45e-2 SMART
LRR_TYP 130 153 8.02e-5 SMART
LRR_TYP 154 177 1.06e-4 SMART
LRRCT 189 241 3.97e-5 SMART
IGc2 255 321 1.59e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122328
AA Change: F423L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113703
Gene: ENSMUSG00000020674
AA Change: F423L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LRRNT 32 63 2.52e-1 SMART
LRR 62 81 4.09e1 SMART
LRR_TYP 82 105 3.69e-4 SMART
LRR_TYP 106 129 1.45e-2 SMART
LRR_TYP 130 153 8.02e-5 SMART
LRR_TYP 154 177 1.06e-4 SMART
LRRCT 189 241 3.97e-5 SMART
IGc2 255 321 1.59e-15 SMART
IGc2 351 416 3.96e-16 SMART
IGc2 442 506 2.96e-15 SMART
IGc2 534 598 1.2e-15 SMART
Pfam:An_peroxidase 738 1286 1.1e-196 PFAM
VWC 1411 1466 8.8e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220271
AA Change: F243L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heme-containing peroxidase that is secreted into the extracellular matrix. It is involved in extracellular matrix formation, and may function in the physiological and pathological fibrogenic response in fibrotic kidney. Mutations in this gene cause corneal opacification and other ocular anomalies, and also microphthalmia and anterior segment dysgenesis. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit abnormal eye development with early-onset glaucoma and progressive retinal dysgenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110079O15Rik C T 1: 87,475,104 T52I probably damaging Het
Abca14 T C 7: 120,216,303 F258S probably damaging Het
Abca3 A G 17: 24,383,985 Y518C probably damaging Het
Ank2 A T 3: 127,046,782 N274K probably damaging Het
Ankrd31 C T 13: 96,832,821 L989F probably damaging Het
Ano6 A G 15: 95,927,582 R354G probably benign Het
Ano8 T C 8: 71,482,190 probably null Het
Arfgef1 T C 1: 10,141,613 Y1735C probably damaging Het
B3gnt8 G A 7: 25,629,234 G363D probably benign Het
Calcrl T C 2: 84,373,385 probably null Het
Cc2d2b A T 19: 40,809,282 D782V unknown Het
Ccdc162 A G 10: 41,655,444 probably null Het
Clcnkb A T 4: 141,407,849 V526D possibly damaging Het
Cnbp A T 6: 87,844,092 C162S probably damaging Het
D6Wsu163e T A 6: 126,954,815 L270Q probably damaging Het
Dnhd1 C T 7: 105,713,648 Q3806* probably null Het
Eepd1 T C 9: 25,483,222 F261L probably benign Het
Fam45a C T 19: 60,834,985 Q353* probably null Het
Fsip2 T A 2: 82,977,337 D1333E possibly damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm5113 T C 7: 30,178,867 F127L probably benign Het
Grk3 A G 5: 112,918,831 S596P possibly damaging Het
Gsk3a A G 7: 25,237,389 V91A possibly damaging Het
Gss T C 2: 155,578,359 K141E probably damaging Het
Il1rl2 A T 1: 40,327,370 probably null Het
Kcnmb1 A G 11: 33,964,825 Y42C probably damaging Het
Krtap16-1 A T 11: 99,986,344 I78N probably damaging Het
Lrp2 C T 2: 69,549,038 S110N possibly damaging Het
Magel2 G T 7: 62,379,693 A782S unknown Het
Map1b C A 13: 99,432,509 E1235* probably null Het
Mcpt1 A C 14: 56,020,063 H222P probably benign Het
Met T A 6: 17,549,138 N996K probably benign Het
Mia C A 7: 27,180,805 Q52H probably damaging Het
Mia T A 7: 27,180,806 Q52L possibly damaging Het
Myh7 T A 14: 54,992,771 K35* probably null Het
Myt1l T A 12: 29,811,469 D83E unknown Het
Nbl1 A G 4: 139,083,550 V111A probably damaging Het
Nid1 T A 13: 13,463,930 V145D probably benign Het
Nif3l1 C T 1: 58,447,494 probably benign Het
Npnt T C 3: 132,886,003 Y500C probably damaging Het
Nubpl T A 12: 52,097,893 probably null Het
Nxpe4 T A 9: 48,398,950 D504E probably damaging Het
Obsl1 A G 1: 75,487,273 V1696A possibly damaging Het
Olfr283 A T 15: 98,378,594 I172N probably damaging Het
Olfr679 A T 7: 105,086,122 R135S possibly damaging Het
P2rx1 A T 11: 73,009,995 H224L probably benign Het
Pald1 A T 10: 61,347,036 probably null Het
Pard6g C T 18: 80,117,196 R175* probably null Het
Pisd A G 5: 32,738,411 I271T probably benign Het
Prrt3 T C 6: 113,495,835 S459G probably damaging Het
Psd3 A T 8: 67,713,293 C328S unknown Het
Psme1 A G 14: 55,580,396 E120G Het
Pum3 A T 19: 27,420,057 M306K possibly damaging Het
Rac3 A G 11: 120,723,245 D118G probably damaging Het
Rnf14 A G 18: 38,313,214 K357E probably benign Het
Rpl23a T C 11: 78,182,894 I40V probably benign Het
Slc5a5 A T 8: 70,892,583 S27T probably damaging Het
Slc7a14 A T 3: 31,223,446 L670Q probably damaging Het
Sst T A 16: 23,889,749 K111* probably null Het
Stxbp4 A G 11: 90,535,441 S514P unknown Het
Susd1 T A 4: 59,390,576 T300S probably benign Het
Synpo2 GTCCTCCTCCTCCTCCTCCTC GTCCTCCTCCTCCTCCTC 3: 123,114,418 probably benign Het
Tmem185b C T 1: 119,526,468 probably benign Het
Tor2a T A 2: 32,761,687 F305I probably damaging Het
Ttk T A 9: 83,868,060 D689E probably damaging Het
Usp25 A G 16: 77,081,533 D615G probably damaging Het
Vmn1r209 A G 13: 22,806,514 V2A probably benign Het
Vmn2r80 A C 10: 79,182,094 E551A probably damaging Het
Wac G T 18: 7,926,104 E636* probably null Het
Wdr53 T A 16: 32,252,312 D158E probably damaging Het
Zbtb7c T C 18: 76,137,081 V80A probably damaging Het
Zcchc11 A T 4: 108,479,211 D44V probably damaging Het
Other mutations in Pxdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Pxdn APN 12 29987099 missense probably damaging 1.00
IGL01152:Pxdn APN 12 30001937 missense probably damaging 0.99
IGL01286:Pxdn APN 12 29982754 missense probably benign 0.04
IGL01323:Pxdn APN 12 29987137 missense probably benign 0.00
IGL01338:Pxdn APN 12 30002797 missense probably damaging 1.00
IGL01341:Pxdn APN 12 30002487 missense probably damaging 1.00
IGL01401:Pxdn APN 12 30001984 missense probably damaging 1.00
IGL01580:Pxdn APN 12 29984493 missense probably benign 0.18
IGL01650:Pxdn APN 12 30002401 missense probably benign 0.01
IGL01679:Pxdn APN 12 29999902 missense probably damaging 0.97
IGL01866:Pxdn APN 12 29984571 missense probably benign 0.02
IGL02354:Pxdn APN 12 29999189 missense probably damaging 1.00
IGL02361:Pxdn APN 12 29999189 missense probably damaging 1.00
IGL02427:Pxdn APN 12 29984532 missense probably damaging 1.00
IGL02955:Pxdn APN 12 30003157 missense probably damaging 1.00
IGL03079:Pxdn APN 12 30002998 missense probably damaging 0.97
IGL03111:Pxdn APN 12 29982756 missense probably damaging 0.99
IGL02988:Pxdn UTSW 12 30003114 nonsense probably null
PIT4280001:Pxdn UTSW 12 29995328 missense probably damaging 0.99
PIT4469001:Pxdn UTSW 12 30005829 missense probably benign 0.00
R0070:Pxdn UTSW 12 29982727 missense probably damaging 0.99
R0070:Pxdn UTSW 12 29982727 missense probably damaging 0.99
R0086:Pxdn UTSW 12 30002419 missense possibly damaging 0.95
R0140:Pxdn UTSW 12 29982754 missense probably benign 0.04
R0201:Pxdn UTSW 12 30002431 missense possibly damaging 0.79
R0282:Pxdn UTSW 12 29984440 nonsense probably null
R0310:Pxdn UTSW 12 30015529 missense probably damaging 1.00
R0426:Pxdn UTSW 12 29987066 missense possibly damaging 0.89
R0468:Pxdn UTSW 12 29994486 missense probably damaging 0.99
R0825:Pxdn UTSW 12 29984996 splice site probably benign
R0885:Pxdn UTSW 12 30003402 missense probably benign 0.30
R1420:Pxdn UTSW 12 30002068 missense probably damaging 1.00
R1588:Pxdn UTSW 12 30002559 missense probably damaging 1.00
R2269:Pxdn UTSW 12 30005775 missense probably damaging 0.97
R2280:Pxdn UTSW 12 29984906 missense probably damaging 0.98
R2504:Pxdn UTSW 12 30003406 missense probably damaging 1.00
R2679:Pxdn UTSW 12 29975569 splice site probably benign
R3116:Pxdn UTSW 12 30002307 missense possibly damaging 0.89
R3607:Pxdn UTSW 12 29990918 missense probably benign 0.04
R4033:Pxdn UTSW 12 30003225 missense probably benign 0.19
R4576:Pxdn UTSW 12 30011923 missense probably benign
R4659:Pxdn UTSW 12 29994553 missense probably benign 0.01
R4681:Pxdn UTSW 12 30012326 missense probably benign 0.45
R4968:Pxdn UTSW 12 30000012 missense probably benign 0.25
R5032:Pxdn UTSW 12 30003141 missense probably benign 0.08
R5232:Pxdn UTSW 12 29990988 missense probably benign 0.08
R5366:Pxdn UTSW 12 30002900 missense probably damaging 1.00
R5504:Pxdn UTSW 12 30002801 missense probably damaging 1.00
R5586:Pxdn UTSW 12 30003142 missense probably damaging 0.99
R5739:Pxdn UTSW 12 29982334 missense probably benign 0.03
R5877:Pxdn UTSW 12 30003046 missense probably damaging 1.00
R6167:Pxdn UTSW 12 29974001 missense probably damaging 1.00
R6191:Pxdn UTSW 12 29982717 missense possibly damaging 0.94
R6200:Pxdn UTSW 12 30003112 missense probably damaging 1.00
R6609:Pxdn UTSW 12 30002941 missense probably benign 0.00
R6628:Pxdn UTSW 12 29999918 missense probably damaging 1.00
R6865:Pxdn UTSW 12 30014583 splice site probably null
R6921:Pxdn UTSW 12 30015505 missense probably damaging 0.96
R6995:Pxdn UTSW 12 29995371 missense possibly damaging 0.95
R7211:Pxdn UTSW 12 29984904 missense possibly damaging 0.77
R7220:Pxdn UTSW 12 29994480 missense probably benign 0.02
R7347:Pxdn UTSW 12 30012261 missense probably benign 0.01
R7402:Pxdn UTSW 12 30002439 missense probably damaging 1.00
R7408:Pxdn UTSW 12 29990945 missense probably benign 0.29
R7413:Pxdn UTSW 12 30002928 missense probably benign 0.00
R7447:Pxdn UTSW 12 29984927 missense probably damaging 1.00
R7572:Pxdn UTSW 12 30006705 missense probably damaging 1.00
R7708:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R7815:Pxdn UTSW 12 30005825 missense probably damaging 0.96
R7972:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8097:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8098:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8205:Pxdn UTSW 12 30006567 missense probably damaging 1.00
R8262:Pxdn UTSW 12 29999196 nonsense probably null
R8335:Pxdn UTSW 12 30002097 missense probably damaging 0.99
R8356:Pxdn UTSW 12 30011890 missense probably damaging 0.99
R8437:Pxdn UTSW 12 30002044 missense probably damaging 1.00
R8456:Pxdn UTSW 12 30011890 missense probably damaging 0.99
R8709:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8772:Pxdn UTSW 12 30015464 missense probably damaging 1.00
Z1177:Pxdn UTSW 12 29990852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTAATCCAGCCGCAGAAC -3'
(R):5'- CAGCTCCTGAAATTGTTCTCTGG -3'

Sequencing Primer
(F):5'- TCTGGAGTGCAGTGCCACAG -3'
(R):5'- CATGGACATGTTCTCAGAAGCATGC -3'
Posted On2021-08-02