Mutagenetix > Incidental Mutation

Incidental Mutation 'R8903:Map1b'

678331

Institutional Source

Beutler Lab

Gene Symbol

Map1b

Ensembl Gene

ENSMUSG00000052727

Gene Name

microtubule-associated protein 1B

Synonyms

Mtap1b, MAP5, Mtap-5, Mtap5, LC1

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8903 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

99421446-99516540 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 99432509 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Stop codon at position 1235 (E1235*)

Ref Sequence

ENSEMBL: ENSMUSP00000068374 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064762]

AlphaFold

P14873

Predicted Effect

probably null
Transcript: ENSMUST00000064762
AA Change: E1235*

SMART Domains

Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: E1235*

Domain	Start	End	E-Value	Type
low complexity region	41	50	N/A	INTRINSIC
Blast:Lactamase_B	270	514	1e-56	BLAST
low complexity region	578	595	N/A	INTRINSIC
low complexity region	597	617	N/A	INTRINSIC
SCOP:d1gkub2	633	735	8e-4	SMART
low complexity region	771	813	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	889	913	N/A	INTRINSIC
low complexity region	935	956	N/A	INTRINSIC
low complexity region	1006	1030	N/A	INTRINSIC
low complexity region	1247	1261	N/A	INTRINSIC
low complexity region	1390	1404	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
low complexity region	1724	1735	N/A	INTRINSIC
Pfam:MAP1B_neuraxin	1891	1907	1.9e-10	PFAM
Pfam:MAP1B_neuraxin	1908	1924	8.3e-11	PFAM
Pfam:MAP1B_neuraxin	1942	1958	3.1e-9	PFAM
Pfam:MAP1B_neuraxin	1959	1975	6.2e-9	PFAM
Pfam:MAP1B_neuraxin	2027	2043	2.9e-10	PFAM
Pfam:MAP1B_neuraxin	2044	2060	3.9e-9	PFAM
low complexity region	2227	2257	N/A	INTRINSIC
low complexity region	2286	2307	N/A	INTRINSIC
low complexity region	2316	2343	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

97% (74/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110079O15Rik	C	T	1: 87,475,104	T52I	probably damaging	Het
Abca14	T	C	7: 120,216,303	F258S	probably damaging	Het
Abca3	A	G	17: 24,383,985	Y518C	probably damaging	Het
Ank2	A	T	3: 127,046,782	N274K	probably damaging	Het
Ankrd31	C	T	13: 96,832,821	L989F	probably damaging	Het
Ano6	A	G	15: 95,927,582	R354G	probably benign	Het
Ano8	T	C	8: 71,482,190		probably null	Het
Arfgef1	T	C	1: 10,141,613	Y1735C	probably damaging	Het
B3gnt8	G	A	7: 25,629,234	G363D	probably benign	Het
Calcrl	T	C	2: 84,373,385		probably null	Het
Cc2d2b	A	T	19: 40,809,282	D782V	unknown	Het
Ccdc162	A	G	10: 41,655,444		probably null	Het
Cdkal1	A	T	13: 29,625,935	*219R	probably null	Het
Clcnkb	A	T	4: 141,407,849	V526D	possibly damaging	Het
Cnbp	A	T	6: 87,844,092	C162S	probably damaging	Het
Coq2	A	G	5: 100,663,790		probably benign	Het
D6Wsu163e	T	A	6: 126,954,815	L270Q	probably damaging	Het
Dnhd1	C	T	7: 105,713,648	Q3806*	probably null	Het
Eepd1	T	C	9: 25,483,222	F261L	probably benign	Het
Fam45a	C	T	19: 60,834,985	Q353*	probably null	Het
Fes	C	T	7: 80,386,811		probably benign	Het
Fsip2	T	A	2: 82,977,337	D1333E	possibly damaging	Het
Gm10800	CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA	CAAGAAAACTGAAAATCA	2: 98,667,016		probably null	Het
Gm5113	T	C	7: 30,178,867	F127L	probably benign	Het
Grk3	A	G	5: 112,918,831	S596P	possibly damaging	Het
Gsk3a	A	G	7: 25,237,389	V91A	possibly damaging	Het
Gss	T	C	2: 155,578,359	K141E	probably damaging	Het
Il1rl2	A	T	1: 40,327,370		probably null	Het
Kcnmb1	A	G	11: 33,964,825	Y42C	probably damaging	Het
Krtap16-1	A	T	11: 99,986,344	I78N	probably damaging	Het
Lrp2	C	T	2: 69,549,038	S110N	possibly damaging	Het
Lrrfip1	T	A	1: 91,085,059		probably benign	Het
Magel2	G	T	7: 62,379,693	A782S	unknown	Het
Mcpt1	A	C	14: 56,020,063	H222P	probably benign	Het
Met	T	A	6: 17,549,138	N996K	probably benign	Het
Mia	C	A	7: 27,180,805	Q52H	probably damaging	Het
Mia	T	A	7: 27,180,806	Q52L	possibly damaging	Het
Myh7	T	A	14: 54,992,771	K35*	probably null	Het
Myt1l	T	A	12: 29,811,469	D83E	unknown	Het
Nbl1	A	G	4: 139,083,550	V111A	probably damaging	Het
Nid1	T	A	13: 13,463,930	V145D	probably benign	Het
Nif3l1	C	T	1: 58,447,494		probably benign	Het
Npnt	T	C	3: 132,886,003	Y500C	probably damaging	Het
Nubpl	T	A	12: 52,097,893		probably null	Het
Nxpe4	T	A	9: 48,398,950	D504E	probably damaging	Het
Obsl1	A	G	1: 75,487,273	V1696A	possibly damaging	Het
Olfr283	A	T	15: 98,378,594	I172N	probably damaging	Het
Olfr679	A	T	7: 105,086,122	R135S	possibly damaging	Het
P2rx1	A	T	11: 73,009,995	H224L	probably benign	Het
Pald1	A	T	10: 61,347,036		probably null	Het
Pard6g	C	T	18: 80,117,196	R175*	probably null	Het
Pisd	A	G	5: 32,738,411	I271T	probably benign	Het
Prrt3	T	C	6: 113,495,835	S459G	probably damaging	Het
Psd3	A	T	8: 67,713,293	C328S	unknown	Het
Psme1	A	G	14: 55,580,396	E120G		Het
Pum3	A	T	19: 27,420,057	M306K	possibly damaging	Het
Pxdn	T	C	12: 29,990,993	F423L	probably benign	Het
Rac3	A	G	11: 120,723,245	D118G	probably damaging	Het
Rnf14	A	G	18: 38,313,214	K357E	probably benign	Het
Rpl23a	T	C	11: 78,182,894	I40V	probably benign	Het
Slc5a5	A	T	8: 70,892,583	S27T	probably damaging	Het
Slc7a14	A	T	3: 31,223,446	L670Q	probably damaging	Het
Sst	T	A	16: 23,889,749	K111*	probably null	Het
Stxbp4	A	G	11: 90,535,441	S514P	unknown	Het
Susd1	T	A	4: 59,390,576	T300S	probably benign	Het
Tecpr1	C	T	5: 144,214,027		probably benign	Het
Tmem185b	C	T	1: 119,526,468		probably benign	Het
Tor2a	T	A	2: 32,761,687	F305I	probably damaging	Het
Ttk	T	A	9: 83,868,060	D689E	probably damaging	Het
Usp25	A	G	16: 77,081,533	D615G	probably damaging	Het
Vmn1r209	A	G	13: 22,806,514	V2A	probably benign	Het
Vmn2r80	A	C	10: 79,182,094	E551A	probably damaging	Het
Wac	G	T	18: 7,926,104	E636*	probably null	Het
Wdr53	T	A	16: 32,252,312	D158E	probably damaging	Het
Zbtb7c	T	C	18: 76,137,081	V80A	probably damaging	Het
Zcchc11	A	T	4: 108,479,211	D44V	probably damaging	Het

Other mutations in Map1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Map1b	APN	13	99429233	missense	unknown
IGL00533:Map1b	APN	13	99432604	missense	unknown
IGL00801:Map1b	APN	13	99430097	missense	unknown
IGL01141:Map1b	APN	13	99434761	missense	probably damaging	1.00
IGL01418:Map1b	APN	13	99431830	missense	unknown
IGL01464:Map1b	APN	13	99432743	missense	unknown
IGL01690:Map1b	APN	13	99435004	missense	probably damaging	1.00
IGL01991:Map1b	APN	13	99429569	missense	unknown
IGL02245:Map1b	APN	13	99431528	missense	unknown
IGL02376:Map1b	APN	13	99435595	missense	probably damaging	1.00
IGL02380:Map1b	APN	13	99431143	missense	unknown
IGL02442:Map1b	APN	13	99508198	missense	probably damaging	1.00
IGL02465:Map1b	APN	13	99433406	missense	unknown
IGL02816:Map1b	APN	13	99441755	missense	probably damaging	1.00
IGL02859:Map1b	APN	13	99433036	missense	unknown
IGL02934:Map1b	APN	13	99435131	missense	probably benign	0.09
IGL02970:Map1b	APN	13	99430734	nonsense	probably null
IGL03148:Map1b	APN	13	99441695	missense	probably damaging	1.00
IGL03401:Map1b	APN	13	99427268	missense	unknown
IGL03138:Map1b	UTSW	13	99425826	missense	unknown
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0035:Map1b	UTSW	13	99435338	missense	probably damaging	1.00
R0069:Map1b	UTSW	13	99429848	missense	unknown
R0315:Map1b	UTSW	13	99431116	missense	unknown
R0539:Map1b	UTSW	13	99434018	missense	unknown
R0548:Map1b	UTSW	13	99431683	missense	unknown
R0613:Map1b	UTSW	13	99441641	missense	probably damaging	1.00
R0730:Map1b	UTSW	13	99429766	nonsense	probably null
R1103:Map1b	UTSW	13	99427466	splice site	probably benign
R1300:Map1b	UTSW	13	99432521	missense	unknown
R1353:Map1b	UTSW	13	99427326	missense	unknown
R1387:Map1b	UTSW	13	99432650	missense	unknown
R1481:Map1b	UTSW	13	99431171	missense	unknown
R1509:Map1b	UTSW	13	99431528	missense	unknown
R1521:Map1b	UTSW	13	99432739	missense	unknown
R1604:Map1b	UTSW	13	99429572	missense	unknown
R1649:Map1b	UTSW	13	99516478	missense	probably benign	0.03
R1651:Map1b	UTSW	13	99432583	missense	unknown
R1661:Map1b	UTSW	13	99431929	missense	unknown
R1665:Map1b	UTSW	13	99431929	missense	unknown
R1770:Map1b	UTSW	13	99430493	missense	unknown
R1926:Map1b	UTSW	13	99430692	missense	unknown
R1928:Map1b	UTSW	13	99430946	missense	unknown
R2093:Map1b	UTSW	13	99429670	missense	unknown
R2110:Map1b	UTSW	13	99431121	missense	unknown
R2116:Map1b	UTSW	13	99430644	missense	unknown
R2164:Map1b	UTSW	13	99429338	missense	unknown
R2207:Map1b	UTSW	13	99431083	missense	unknown
R2273:Map1b	UTSW	13	99432084	missense	unknown
R2443:Map1b	UTSW	13	99430411	missense	unknown
R3054:Map1b	UTSW	13	99432742	missense	unknown
R3766:Map1b	UTSW	13	99434087	missense	unknown
R3911:Map1b	UTSW	13	99431072	missense	unknown
R4005:Map1b	UTSW	13	99429907	missense	unknown
R4130:Map1b	UTSW	13	99431680	missense	unknown
R4513:Map1b	UTSW	13	99444233	missense	probably damaging	1.00
R4613:Map1b	UTSW	13	99430302	nonsense	probably null
R4633:Map1b	UTSW	13	99434942	missense	probably damaging	1.00
R4646:Map1b	UTSW	13	99432469	missense	unknown
R4690:Map1b	UTSW	13	99431068	missense	unknown
R4704:Map1b	UTSW	13	99430475	missense	unknown
R4836:Map1b	UTSW	13	99431054	missense	unknown
R4916:Map1b	UTSW	13	99433300	missense	unknown
R4951:Map1b	UTSW	13	99432427	missense	unknown
R4960:Map1b	UTSW	13	99432212	missense	probably benign	0.23
R4961:Map1b	UTSW	13	99435653	missense	probably damaging	1.00
R5030:Map1b	UTSW	13	99434174	missense	unknown
R5090:Map1b	UTSW	13	99430026	nonsense	probably null
R5469:Map1b	UTSW	13	99429338	missense	unknown
R5820:Map1b	UTSW	13	99432824	missense	unknown
R5885:Map1b	UTSW	13	99430081	missense	unknown
R5915:Map1b	UTSW	13	99430331	missense	unknown
R5923:Map1b	UTSW	13	99433153	missense	unknown
R6063:Map1b	UTSW	13	99431137	missense	unknown
R6102:Map1b	UTSW	13	99425873	missense	unknown
R6218:Map1b	UTSW	13	99433206	missense	unknown
R6435:Map1b	UTSW	13	99516363	missense	probably damaging	0.99
R6663:Map1b	UTSW	13	99430022	missense	unknown
R6765:Map1b	UTSW	13	99425941	missense	unknown
R6860:Map1b	UTSW	13	99434767	missense	probably damaging	1.00
R6997:Map1b	UTSW	13	99430634	missense	unknown
R7001:Map1b	UTSW	13	99430593	missense	unknown
R7310:Map1b	UTSW	13	99433655	missense	unknown
R7349:Map1b	UTSW	13	99433640	missense	unknown
R7448:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7449:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7452:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7810:Map1b	UTSW	13	99431882	missense	unknown
R7820:Map1b	UTSW	13	99431177	missense	unknown
R8396:Map1b	UTSW	13	99434113	missense	unknown
R8470:Map1b	UTSW	13	99516442	missense	probably damaging	0.98
R8535:Map1b	UTSW	13	99435154	missense	probably damaging	1.00
R8777:Map1b	UTSW	13	99430796	missense	unknown
R8777-TAIL:Map1b	UTSW	13	99430796	missense	unknown
R8812:Map1b	UTSW	13	99432815	missense	unknown
R8928:Map1b	UTSW	13	99432116	missense	unknown
R8954:Map1b	UTSW	13	99434227	missense	unknown
R9164:Map1b	UTSW	13	99425843	missense	unknown
R9164:Map1b	UTSW	13	99432308	nonsense	probably null
R9190:Map1b	UTSW	13	99435406	missense	probably damaging	0.99
R9334:Map1b	UTSW	13	99431640	missense	unknown
R9339:Map1b	UTSW	13	99431062	missense	unknown
R9357:Map1b	UTSW	13	99430200	nonsense	probably null
R9430:Map1b	UTSW	13	99434108	missense	unknown
RF003:Map1b	UTSW	13	99430750	missense	unknown
X0019:Map1b	UTSW	13	99429968	missense	unknown
X0019:Map1b	UTSW	13	99432412	missense	unknown
Z1088:Map1b	UTSW	13	99508115	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- ATGTTCTTCAACTACTGCCTGGG -3'
(R):5'- ACTCCAAACCTGCTGTTGC -3'

Sequencing Primer
(F):5'- TCACTCCAGGGGACACTGAC -3'
(R):5'- CATCATTCAATGGATTGTCAGAAGGG -3'

Posted On

2021-08-02