Incidental Mutation 'R8903:Map1b'
ID 678331
Institutional Source Beutler Lab
Gene Symbol Map1b
Ensembl Gene ENSMUSG00000052727
Gene Name microtubule-associated protein 1B
Synonyms Mtap1b, Mtap-5, MAP5, Mtap5, LC1
MMRRC Submission 068760-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8903 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 99557954-99653048 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 99569017 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 1235 (E1235*)
Ref Sequence ENSEMBL: ENSMUSP00000068374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064762]
AlphaFold P14873
Predicted Effect probably null
Transcript: ENSMUST00000064762
AA Change: E1235*
SMART Domains Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: E1235*

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
Blast:Lactamase_B 270 514 1e-56 BLAST
low complexity region 578 595 N/A INTRINSIC
low complexity region 597 617 N/A INTRINSIC
SCOP:d1gkub2 633 735 8e-4 SMART
low complexity region 771 813 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 889 913 N/A INTRINSIC
low complexity region 935 956 N/A INTRINSIC
low complexity region 1006 1030 N/A INTRINSIC
low complexity region 1247 1261 N/A INTRINSIC
low complexity region 1390 1404 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
low complexity region 1724 1735 N/A INTRINSIC
Pfam:MAP1B_neuraxin 1891 1907 1.9e-10 PFAM
Pfam:MAP1B_neuraxin 1908 1924 8.3e-11 PFAM
Pfam:MAP1B_neuraxin 1942 1958 3.1e-9 PFAM
Pfam:MAP1B_neuraxin 1959 1975 6.2e-9 PFAM
Pfam:MAP1B_neuraxin 2027 2043 2.9e-10 PFAM
Pfam:MAP1B_neuraxin 2044 2060 3.9e-9 PFAM
low complexity region 2227 2257 N/A INTRINSIC
low complexity region 2286 2307 N/A INTRINSIC
low complexity region 2316 2343 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 119,815,526 (GRCm39) F258S probably damaging Het
Abca3 A G 17: 24,602,959 (GRCm39) Y518C probably damaging Het
Ank2 A T 3: 126,840,431 (GRCm39) N274K probably damaging Het
Ankrd31 C T 13: 96,969,329 (GRCm39) L989F probably damaging Het
Ano6 A G 15: 95,825,463 (GRCm39) R354G probably benign Het
Ano8 T C 8: 71,934,834 (GRCm39) probably null Het
Arfgef1 T C 1: 10,211,838 (GRCm39) Y1735C probably damaging Het
B3gnt8 G A 7: 25,328,659 (GRCm39) G363D probably benign Het
Calcrl T C 2: 84,203,729 (GRCm39) probably null Het
Cc2d2b A T 19: 40,797,726 (GRCm39) D782V unknown Het
Ccdc162 A G 10: 41,531,440 (GRCm39) probably null Het
Cdkal1 A T 13: 29,809,918 (GRCm39) *219R probably null Het
Clcnkb A T 4: 141,135,160 (GRCm39) V526D possibly damaging Het
Cnbp A T 6: 87,821,074 (GRCm39) C162S probably damaging Het
Coq2 A G 5: 100,811,656 (GRCm39) probably benign Het
D6Wsu163e T A 6: 126,931,778 (GRCm39) L270Q probably damaging Het
Dennd10 C T 19: 60,823,423 (GRCm39) Q353* probably null Het
Dnhd1 C T 7: 105,362,855 (GRCm39) Q3806* probably null Het
Eepd1 T C 9: 25,394,518 (GRCm39) F261L probably benign Het
Fes C T 7: 80,036,559 (GRCm39) probably benign Het
Fsip2 T A 2: 82,807,681 (GRCm39) D1333E possibly damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,497,361 (GRCm39) probably null Het
Gm5113 T C 7: 29,878,292 (GRCm39) F127L probably benign Het
Grk3 A G 5: 113,066,697 (GRCm39) S596P possibly damaging Het
Gsk3a A G 7: 24,936,814 (GRCm39) V91A possibly damaging Het
Gss T C 2: 155,420,279 (GRCm39) K141E probably damaging Het
Il1rl2 A T 1: 40,366,530 (GRCm39) probably null Het
Kcnmb1 A G 11: 33,914,825 (GRCm39) Y42C probably damaging Het
Krtap16-1 A T 11: 99,877,170 (GRCm39) I78N probably damaging Het
Lrp2 C T 2: 69,379,382 (GRCm39) S110N possibly damaging Het
Lrrfip1 T A 1: 91,012,781 (GRCm39) probably benign Het
Magel2 G T 7: 62,029,441 (GRCm39) A782S unknown Het
Mcpt1 A C 14: 56,257,520 (GRCm39) H222P probably benign Het
Met T A 6: 17,549,137 (GRCm39) N996K probably benign Het
Mia C A 7: 26,880,230 (GRCm39) Q52H probably damaging Het
Mia T A 7: 26,880,231 (GRCm39) Q52L possibly damaging Het
Myh7 T A 14: 55,230,228 (GRCm39) K35* probably null Het
Myt1l T A 12: 29,861,468 (GRCm39) D83E unknown Het
Nbl1 A G 4: 138,810,861 (GRCm39) V111A probably damaging Het
Nid1 T A 13: 13,638,515 (GRCm39) V145D probably benign Het
Nif3l1 C T 1: 58,486,653 (GRCm39) probably benign Het
Npnt T C 3: 132,591,764 (GRCm39) Y500C probably damaging Het
Nubpl T A 12: 52,144,676 (GRCm39) probably null Het
Nxpe4 T A 9: 48,310,250 (GRCm39) D504E probably damaging Het
Obsl1 A G 1: 75,463,917 (GRCm39) V1696A possibly damaging Het
Or56a3 A T 7: 104,735,329 (GRCm39) R135S possibly damaging Het
Or8s2 A T 15: 98,276,475 (GRCm39) I172N probably damaging Het
P2rx1 A T 11: 72,900,821 (GRCm39) H224L probably benign Het
Pald1 A T 10: 61,182,815 (GRCm39) probably null Het
Pard6g C T 18: 80,160,411 (GRCm39) R175* probably null Het
Pisd A G 5: 32,895,755 (GRCm39) I271T probably benign Het
Prrt3 T C 6: 113,472,796 (GRCm39) S459G probably damaging Het
Psd3 A T 8: 68,165,945 (GRCm39) C328S unknown Het
Psme1 A G 14: 55,817,853 (GRCm39) E120G Het
Pum3 A T 19: 27,397,457 (GRCm39) M306K possibly damaging Het
Pxdn T C 12: 30,040,992 (GRCm39) F423L probably benign Het
Rac3 A G 11: 120,614,071 (GRCm39) D118G probably damaging Het
Rnf14 A G 18: 38,446,267 (GRCm39) K357E probably benign Het
Rpl23a T C 11: 78,073,720 (GRCm39) I40V probably benign Het
Slc5a5 A T 8: 71,345,227 (GRCm39) S27T probably damaging Het
Slc7a14 A T 3: 31,277,595 (GRCm39) L670Q probably damaging Het
Snorc C T 1: 87,402,826 (GRCm39) T52I probably damaging Het
Sst T A 16: 23,708,499 (GRCm39) K111* probably null Het
Stxbp4 A G 11: 90,426,267 (GRCm39) S514P unknown Het
Susd1 T A 4: 59,390,576 (GRCm39) T300S probably benign Het
Tecpr1 C T 5: 144,150,845 (GRCm39) probably benign Het
Tmem185b C T 1: 119,454,198 (GRCm39) probably benign Het
Tor2a T A 2: 32,651,699 (GRCm39) F305I probably damaging Het
Ttk T A 9: 83,750,113 (GRCm39) D689E probably damaging Het
Tut4 A T 4: 108,336,408 (GRCm39) D44V probably damaging Het
Usp25 A G 16: 76,878,421 (GRCm39) D615G probably damaging Het
Vmn1r209 A G 13: 22,990,684 (GRCm39) V2A probably benign Het
Vmn2r80 A C 10: 79,017,928 (GRCm39) E551A probably damaging Het
Wac G T 18: 7,926,104 (GRCm39) E636* probably null Het
Wdr53 T A 16: 32,071,130 (GRCm39) D158E probably damaging Het
Zbtb7c T C 18: 76,270,152 (GRCm39) V80A probably damaging Het
Other mutations in Map1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Map1b APN 13 99,565,741 (GRCm39) missense unknown
IGL00533:Map1b APN 13 99,569,112 (GRCm39) missense unknown
IGL00801:Map1b APN 13 99,566,605 (GRCm39) missense unknown
IGL01141:Map1b APN 13 99,571,269 (GRCm39) missense probably damaging 1.00
IGL01418:Map1b APN 13 99,568,338 (GRCm39) missense unknown
IGL01464:Map1b APN 13 99,569,251 (GRCm39) missense unknown
IGL01690:Map1b APN 13 99,571,512 (GRCm39) missense probably damaging 1.00
IGL01991:Map1b APN 13 99,566,077 (GRCm39) missense unknown
IGL02245:Map1b APN 13 99,568,036 (GRCm39) missense unknown
IGL02376:Map1b APN 13 99,572,103 (GRCm39) missense probably damaging 1.00
IGL02380:Map1b APN 13 99,567,651 (GRCm39) missense unknown
IGL02442:Map1b APN 13 99,644,706 (GRCm39) missense probably damaging 1.00
IGL02465:Map1b APN 13 99,569,914 (GRCm39) missense unknown
IGL02816:Map1b APN 13 99,578,263 (GRCm39) missense probably damaging 1.00
IGL02859:Map1b APN 13 99,569,544 (GRCm39) missense unknown
IGL02934:Map1b APN 13 99,571,639 (GRCm39) missense probably benign 0.09
IGL02970:Map1b APN 13 99,567,242 (GRCm39) nonsense probably null
IGL03148:Map1b APN 13 99,578,203 (GRCm39) missense probably damaging 1.00
IGL03401:Map1b APN 13 99,563,776 (GRCm39) missense unknown
IGL03138:Map1b UTSW 13 99,562,334 (GRCm39) missense unknown
R0006:Map1b UTSW 13 99,571,810 (GRCm39) missense probably damaging 1.00
R0006:Map1b UTSW 13 99,571,810 (GRCm39) missense probably damaging 1.00
R0035:Map1b UTSW 13 99,571,846 (GRCm39) missense probably damaging 1.00
R0069:Map1b UTSW 13 99,566,356 (GRCm39) missense unknown
R0315:Map1b UTSW 13 99,567,624 (GRCm39) missense unknown
R0539:Map1b UTSW 13 99,570,526 (GRCm39) missense unknown
R0548:Map1b UTSW 13 99,568,191 (GRCm39) missense unknown
R0613:Map1b UTSW 13 99,578,149 (GRCm39) missense probably damaging 1.00
R0730:Map1b UTSW 13 99,566,274 (GRCm39) nonsense probably null
R1103:Map1b UTSW 13 99,563,974 (GRCm39) splice site probably benign
R1300:Map1b UTSW 13 99,569,029 (GRCm39) missense unknown
R1353:Map1b UTSW 13 99,563,834 (GRCm39) missense unknown
R1387:Map1b UTSW 13 99,569,158 (GRCm39) missense unknown
R1481:Map1b UTSW 13 99,567,679 (GRCm39) missense unknown
R1509:Map1b UTSW 13 99,568,036 (GRCm39) missense unknown
R1521:Map1b UTSW 13 99,569,247 (GRCm39) missense unknown
R1604:Map1b UTSW 13 99,566,080 (GRCm39) missense unknown
R1649:Map1b UTSW 13 99,652,986 (GRCm39) missense probably benign 0.03
R1651:Map1b UTSW 13 99,569,091 (GRCm39) missense unknown
R1661:Map1b UTSW 13 99,568,437 (GRCm39) missense unknown
R1665:Map1b UTSW 13 99,568,437 (GRCm39) missense unknown
R1770:Map1b UTSW 13 99,567,001 (GRCm39) missense unknown
R1926:Map1b UTSW 13 99,567,200 (GRCm39) missense unknown
R1928:Map1b UTSW 13 99,567,454 (GRCm39) missense unknown
R2093:Map1b UTSW 13 99,566,178 (GRCm39) missense unknown
R2110:Map1b UTSW 13 99,567,629 (GRCm39) missense unknown
R2116:Map1b UTSW 13 99,567,152 (GRCm39) missense unknown
R2164:Map1b UTSW 13 99,565,846 (GRCm39) missense unknown
R2207:Map1b UTSW 13 99,567,591 (GRCm39) missense unknown
R2273:Map1b UTSW 13 99,568,592 (GRCm39) missense unknown
R2443:Map1b UTSW 13 99,566,919 (GRCm39) missense unknown
R3054:Map1b UTSW 13 99,569,250 (GRCm39) missense unknown
R3766:Map1b UTSW 13 99,570,595 (GRCm39) missense unknown
R3911:Map1b UTSW 13 99,567,580 (GRCm39) missense unknown
R4005:Map1b UTSW 13 99,566,415 (GRCm39) missense unknown
R4130:Map1b UTSW 13 99,568,188 (GRCm39) missense unknown
R4513:Map1b UTSW 13 99,580,741 (GRCm39) missense probably damaging 1.00
R4613:Map1b UTSW 13 99,566,810 (GRCm39) nonsense probably null
R4633:Map1b UTSW 13 99,571,450 (GRCm39) missense probably damaging 1.00
R4646:Map1b UTSW 13 99,568,977 (GRCm39) missense unknown
R4690:Map1b UTSW 13 99,567,576 (GRCm39) missense unknown
R4704:Map1b UTSW 13 99,566,983 (GRCm39) missense unknown
R4836:Map1b UTSW 13 99,567,562 (GRCm39) missense unknown
R4916:Map1b UTSW 13 99,569,808 (GRCm39) missense unknown
R4951:Map1b UTSW 13 99,568,935 (GRCm39) missense unknown
R4960:Map1b UTSW 13 99,568,720 (GRCm39) missense probably benign 0.23
R4961:Map1b UTSW 13 99,572,161 (GRCm39) missense probably damaging 1.00
R5030:Map1b UTSW 13 99,570,682 (GRCm39) missense unknown
R5090:Map1b UTSW 13 99,566,534 (GRCm39) nonsense probably null
R5469:Map1b UTSW 13 99,565,846 (GRCm39) missense unknown
R5820:Map1b UTSW 13 99,569,332 (GRCm39) missense unknown
R5885:Map1b UTSW 13 99,566,589 (GRCm39) missense unknown
R5915:Map1b UTSW 13 99,566,839 (GRCm39) missense unknown
R5923:Map1b UTSW 13 99,569,661 (GRCm39) missense unknown
R6063:Map1b UTSW 13 99,567,645 (GRCm39) missense unknown
R6102:Map1b UTSW 13 99,562,381 (GRCm39) missense unknown
R6218:Map1b UTSW 13 99,569,714 (GRCm39) missense unknown
R6435:Map1b UTSW 13 99,652,871 (GRCm39) missense probably damaging 0.99
R6663:Map1b UTSW 13 99,566,530 (GRCm39) missense unknown
R6765:Map1b UTSW 13 99,562,449 (GRCm39) missense unknown
R6860:Map1b UTSW 13 99,571,275 (GRCm39) missense probably damaging 1.00
R6997:Map1b UTSW 13 99,567,142 (GRCm39) missense unknown
R7001:Map1b UTSW 13 99,567,101 (GRCm39) missense unknown
R7310:Map1b UTSW 13 99,570,163 (GRCm39) missense unknown
R7349:Map1b UTSW 13 99,570,148 (GRCm39) missense unknown
R7448:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7449:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7452:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7810:Map1b UTSW 13 99,568,390 (GRCm39) missense unknown
R7820:Map1b UTSW 13 99,567,685 (GRCm39) missense unknown
R8396:Map1b UTSW 13 99,570,621 (GRCm39) missense unknown
R8470:Map1b UTSW 13 99,652,950 (GRCm39) missense probably damaging 0.98
R8535:Map1b UTSW 13 99,571,662 (GRCm39) missense probably damaging 1.00
R8777:Map1b UTSW 13 99,567,304 (GRCm39) missense unknown
R8777-TAIL:Map1b UTSW 13 99,567,304 (GRCm39) missense unknown
R8812:Map1b UTSW 13 99,569,323 (GRCm39) missense unknown
R8928:Map1b UTSW 13 99,568,624 (GRCm39) missense unknown
R8954:Map1b UTSW 13 99,570,735 (GRCm39) missense unknown
R9164:Map1b UTSW 13 99,568,816 (GRCm39) nonsense probably null
R9164:Map1b UTSW 13 99,562,351 (GRCm39) missense unknown
R9190:Map1b UTSW 13 99,571,914 (GRCm39) missense probably damaging 0.99
R9334:Map1b UTSW 13 99,568,148 (GRCm39) missense unknown
R9339:Map1b UTSW 13 99,567,570 (GRCm39) missense unknown
R9357:Map1b UTSW 13 99,566,708 (GRCm39) nonsense probably null
R9430:Map1b UTSW 13 99,570,616 (GRCm39) missense unknown
RF003:Map1b UTSW 13 99,567,258 (GRCm39) missense unknown
X0019:Map1b UTSW 13 99,568,920 (GRCm39) missense unknown
X0019:Map1b UTSW 13 99,566,476 (GRCm39) missense unknown
Z1088:Map1b UTSW 13 99,644,623 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ATGTTCTTCAACTACTGCCTGGG -3'
(R):5'- ACTCCAAACCTGCTGTTGC -3'

Sequencing Primer
(F):5'- TCACTCCAGGGGACACTGAC -3'
(R):5'- CATCATTCAATGGATTGTCAGAAGGG -3'
Posted On 2021-08-02