Incidental Mutation 'R8903:Sst'
ID 678337
Institutional Source Beutler Lab
Gene Symbol Sst
Ensembl Gene ENSMUSG00000004366
Gene Name somatostatin
Synonyms preprosomatostatin, Smst, SOM, SRIF
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8903 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 23889573-23890958 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 23889749 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 111 (K111*)
Ref Sequence ENSEMBL: ENSMUSP00000004480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004480]
AlphaFold P60041
Predicted Effect probably null
Transcript: ENSMUST00000004480
AA Change: K111*
SMART Domains Protein: ENSMUSP00000004480
Gene: ENSMUSG00000004366
AA Change: K111*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Somatostatin 99 116 5.9e-15 PFAM
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The hormone somatostatin has active 14 aa and 28 aa forms that are produced by alternate cleavage of the single preproprotein encoded by this gene. Somatostatin is expressed throughout the body and inhibits the release of numerous secondary hormones by binding to high-affinity G-protein-coupled somatostatin receptors. This hormone is an important regulator of the endocrine system through its interactions with pituitary growth hormone, thyroid stimulating hormone, and most hormones of the gastrointestinal tract. Somatostatin also affects rates of neurotransmission in the central nervous system and proliferation of both normal and tumorigenic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show altered GH secretory dynamics, hypergastremia, and reduced hippocampal bursting and excitatory transmission. Mice homozygous for another null allele show impaired motor learning, higher GH and corticosterone levels,gastric fundus hyperplasia and hyperacidity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110079O15Rik C T 1: 87,475,104 T52I probably damaging Het
Abca14 T C 7: 120,216,303 F258S probably damaging Het
Abca3 A G 17: 24,383,985 Y518C probably damaging Het
Ank2 A T 3: 127,046,782 N274K probably damaging Het
Ankrd31 C T 13: 96,832,821 L989F probably damaging Het
Ano6 A G 15: 95,927,582 R354G probably benign Het
Ano8 T C 8: 71,482,190 probably null Het
Arfgef1 T C 1: 10,141,613 Y1735C probably damaging Het
B3gnt8 G A 7: 25,629,234 G363D probably benign Het
Calcrl T C 2: 84,373,385 probably null Het
Cc2d2b A T 19: 40,809,282 D782V unknown Het
Ccdc162 A G 10: 41,655,444 probably null Het
Cdkal1 A T 13: 29,625,935 *219R probably null Het
Clcnkb A T 4: 141,407,849 V526D possibly damaging Het
Cnbp A T 6: 87,844,092 C162S probably damaging Het
Coq2 A G 5: 100,663,790 probably benign Het
D6Wsu163e T A 6: 126,954,815 L270Q probably damaging Het
Dnhd1 C T 7: 105,713,648 Q3806* probably null Het
Eepd1 T C 9: 25,483,222 F261L probably benign Het
Fam45a C T 19: 60,834,985 Q353* probably null Het
Fes C T 7: 80,386,811 probably benign Het
Fsip2 T A 2: 82,977,337 D1333E possibly damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gm5113 T C 7: 30,178,867 F127L probably benign Het
Grk3 A G 5: 112,918,831 S596P possibly damaging Het
Gsk3a A G 7: 25,237,389 V91A possibly damaging Het
Gss T C 2: 155,578,359 K141E probably damaging Het
Il1rl2 A T 1: 40,327,370 probably null Het
Kcnmb1 A G 11: 33,964,825 Y42C probably damaging Het
Krtap16-1 A T 11: 99,986,344 I78N probably damaging Het
Lrp2 C T 2: 69,549,038 S110N possibly damaging Het
Lrrfip1 T A 1: 91,085,059 probably benign Het
Magel2 G T 7: 62,379,693 A782S unknown Het
Map1b C A 13: 99,432,509 E1235* probably null Het
Mcpt1 A C 14: 56,020,063 H222P probably benign Het
Met T A 6: 17,549,138 N996K probably benign Het
Mia C A 7: 27,180,805 Q52H probably damaging Het
Mia T A 7: 27,180,806 Q52L possibly damaging Het
Myh7 T A 14: 54,992,771 K35* probably null Het
Myt1l T A 12: 29,811,469 D83E unknown Het
Nbl1 A G 4: 139,083,550 V111A probably damaging Het
Nid1 T A 13: 13,463,930 V145D probably benign Het
Nif3l1 C T 1: 58,447,494 probably benign Het
Npnt T C 3: 132,886,003 Y500C probably damaging Het
Nubpl T A 12: 52,097,893 probably null Het
Nxpe4 T A 9: 48,398,950 D504E probably damaging Het
Obsl1 A G 1: 75,487,273 V1696A possibly damaging Het
Olfr283 A T 15: 98,378,594 I172N probably damaging Het
Olfr679 A T 7: 105,086,122 R135S possibly damaging Het
P2rx1 A T 11: 73,009,995 H224L probably benign Het
Pald1 A T 10: 61,347,036 probably null Het
Pard6g C T 18: 80,117,196 R175* probably null Het
Pisd A G 5: 32,738,411 I271T probably benign Het
Prrt3 T C 6: 113,495,835 S459G probably damaging Het
Psd3 A T 8: 67,713,293 C328S unknown Het
Psme1 A G 14: 55,580,396 E120G Het
Pum3 A T 19: 27,420,057 M306K possibly damaging Het
Pxdn T C 12: 29,990,993 F423L probably benign Het
Rac3 A G 11: 120,723,245 D118G probably damaging Het
Rnf14 A G 18: 38,313,214 K357E probably benign Het
Rpl23a T C 11: 78,182,894 I40V probably benign Het
Slc5a5 A T 8: 70,892,583 S27T probably damaging Het
Slc7a14 A T 3: 31,223,446 L670Q probably damaging Het
Stxbp4 A G 11: 90,535,441 S514P unknown Het
Susd1 T A 4: 59,390,576 T300S probably benign Het
Tecpr1 C T 5: 144,214,027 probably benign Het
Tmem185b C T 1: 119,526,468 probably benign Het
Tor2a T A 2: 32,761,687 F305I probably damaging Het
Ttk T A 9: 83,868,060 D689E probably damaging Het
Usp25 A G 16: 77,081,533 D615G probably damaging Het
Vmn1r209 A G 13: 22,806,514 V2A probably benign Het
Vmn2r80 A C 10: 79,182,094 E551A probably damaging Het
Wac G T 18: 7,926,104 E636* probably null Het
Wdr53 T A 16: 32,252,312 D158E probably damaging Het
Zbtb7c T C 18: 76,137,081 V80A probably damaging Het
Zcchc11 A T 4: 108,479,211 D44V probably damaging Het
Other mutations in Sst
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1472:Sst UTSW 16 23890698 missense probably benign
R1853:Sst UTSW 16 23890653 missense probably damaging 1.00
R2209:Sst UTSW 16 23889808 missense probably benign 0.05
R3919:Sst UTSW 16 23889841 missense possibly damaging 0.59
R4350:Sst UTSW 16 23889815 missense probably damaging 0.99
R4351:Sst UTSW 16 23889815 missense probably damaging 0.99
R4352:Sst UTSW 16 23889815 missense probably damaging 0.99
R5586:Sst UTSW 16 23889737 missense probably damaging 1.00
R6844:Sst UTSW 16 23889842 missense probably benign 0.00
R7492:Sst UTSW 16 23889826 missense probably damaging 1.00
R9417:Sst UTSW 16 23889737 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGAAGTCAAACGCTTGCTCTTC -3'
(R):5'- TCACTGCCCTATCCAGGAAC -3'

Sequencing Primer
(F):5'- AGTCAAACGCTTGCTCTTCATAATC -3'
(R):5'- AGGAACTGGCCAAGTACTTCTTG -3'
Posted On 2021-08-02