Incidental Mutation 'R8903:Sst'
ID 678337
Institutional Source Beutler Lab
Gene Symbol Sst
Ensembl Gene ENSMUSG00000004366
Gene Name somatostatin
Synonyms Smst, preprosomatostatin, SRIF, SOM
MMRRC Submission 068760-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8903 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 23708323-23709708 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 23708499 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 111 (K111*)
Ref Sequence ENSEMBL: ENSMUSP00000004480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004480]
AlphaFold P60041
Predicted Effect probably null
Transcript: ENSMUST00000004480
AA Change: K111*
SMART Domains Protein: ENSMUSP00000004480
Gene: ENSMUSG00000004366
AA Change: K111*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Somatostatin 99 116 5.9e-15 PFAM
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The hormone somatostatin has active 14 aa and 28 aa forms that are produced by alternate cleavage of the single preproprotein encoded by this gene. Somatostatin is expressed throughout the body and inhibits the release of numerous secondary hormones by binding to high-affinity G-protein-coupled somatostatin receptors. This hormone is an important regulator of the endocrine system through its interactions with pituitary growth hormone, thyroid stimulating hormone, and most hormones of the gastrointestinal tract. Somatostatin also affects rates of neurotransmission in the central nervous system and proliferation of both normal and tumorigenic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show altered GH secretory dynamics, hypergastremia, and reduced hippocampal bursting and excitatory transmission. Mice homozygous for another null allele show impaired motor learning, higher GH and corticosterone levels,gastric fundus hyperplasia and hyperacidity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T C 7: 119,815,526 (GRCm39) F258S probably damaging Het
Abca3 A G 17: 24,602,959 (GRCm39) Y518C probably damaging Het
Ank2 A T 3: 126,840,431 (GRCm39) N274K probably damaging Het
Ankrd31 C T 13: 96,969,329 (GRCm39) L989F probably damaging Het
Ano6 A G 15: 95,825,463 (GRCm39) R354G probably benign Het
Ano8 T C 8: 71,934,834 (GRCm39) probably null Het
Arfgef1 T C 1: 10,211,838 (GRCm39) Y1735C probably damaging Het
B3gnt8 G A 7: 25,328,659 (GRCm39) G363D probably benign Het
Calcrl T C 2: 84,203,729 (GRCm39) probably null Het
Cc2d2b A T 19: 40,797,726 (GRCm39) D782V unknown Het
Ccdc162 A G 10: 41,531,440 (GRCm39) probably null Het
Cdkal1 A T 13: 29,809,918 (GRCm39) *219R probably null Het
Clcnkb A T 4: 141,135,160 (GRCm39) V526D possibly damaging Het
Cnbp A T 6: 87,821,074 (GRCm39) C162S probably damaging Het
Coq2 A G 5: 100,811,656 (GRCm39) probably benign Het
D6Wsu163e T A 6: 126,931,778 (GRCm39) L270Q probably damaging Het
Dennd10 C T 19: 60,823,423 (GRCm39) Q353* probably null Het
Dnhd1 C T 7: 105,362,855 (GRCm39) Q3806* probably null Het
Eepd1 T C 9: 25,394,518 (GRCm39) F261L probably benign Het
Fes C T 7: 80,036,559 (GRCm39) probably benign Het
Fsip2 T A 2: 82,807,681 (GRCm39) D1333E possibly damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,497,361 (GRCm39) probably null Het
Gm5113 T C 7: 29,878,292 (GRCm39) F127L probably benign Het
Grk3 A G 5: 113,066,697 (GRCm39) S596P possibly damaging Het
Gsk3a A G 7: 24,936,814 (GRCm39) V91A possibly damaging Het
Gss T C 2: 155,420,279 (GRCm39) K141E probably damaging Het
Il1rl2 A T 1: 40,366,530 (GRCm39) probably null Het
Kcnmb1 A G 11: 33,914,825 (GRCm39) Y42C probably damaging Het
Krtap16-1 A T 11: 99,877,170 (GRCm39) I78N probably damaging Het
Lrp2 C T 2: 69,379,382 (GRCm39) S110N possibly damaging Het
Lrrfip1 T A 1: 91,012,781 (GRCm39) probably benign Het
Magel2 G T 7: 62,029,441 (GRCm39) A782S unknown Het
Map1b C A 13: 99,569,017 (GRCm39) E1235* probably null Het
Mcpt1 A C 14: 56,257,520 (GRCm39) H222P probably benign Het
Met T A 6: 17,549,137 (GRCm39) N996K probably benign Het
Mia C A 7: 26,880,230 (GRCm39) Q52H probably damaging Het
Mia T A 7: 26,880,231 (GRCm39) Q52L possibly damaging Het
Myh7 T A 14: 55,230,228 (GRCm39) K35* probably null Het
Myt1l T A 12: 29,861,468 (GRCm39) D83E unknown Het
Nbl1 A G 4: 138,810,861 (GRCm39) V111A probably damaging Het
Nid1 T A 13: 13,638,515 (GRCm39) V145D probably benign Het
Nif3l1 C T 1: 58,486,653 (GRCm39) probably benign Het
Npnt T C 3: 132,591,764 (GRCm39) Y500C probably damaging Het
Nubpl T A 12: 52,144,676 (GRCm39) probably null Het
Nxpe4 T A 9: 48,310,250 (GRCm39) D504E probably damaging Het
Obsl1 A G 1: 75,463,917 (GRCm39) V1696A possibly damaging Het
Or56a3 A T 7: 104,735,329 (GRCm39) R135S possibly damaging Het
Or8s2 A T 15: 98,276,475 (GRCm39) I172N probably damaging Het
P2rx1 A T 11: 72,900,821 (GRCm39) H224L probably benign Het
Pald1 A T 10: 61,182,815 (GRCm39) probably null Het
Pard6g C T 18: 80,160,411 (GRCm39) R175* probably null Het
Pisd A G 5: 32,895,755 (GRCm39) I271T probably benign Het
Prrt3 T C 6: 113,472,796 (GRCm39) S459G probably damaging Het
Psd3 A T 8: 68,165,945 (GRCm39) C328S unknown Het
Psme1 A G 14: 55,817,853 (GRCm39) E120G Het
Pum3 A T 19: 27,397,457 (GRCm39) M306K possibly damaging Het
Pxdn T C 12: 30,040,992 (GRCm39) F423L probably benign Het
Rac3 A G 11: 120,614,071 (GRCm39) D118G probably damaging Het
Rnf14 A G 18: 38,446,267 (GRCm39) K357E probably benign Het
Rpl23a T C 11: 78,073,720 (GRCm39) I40V probably benign Het
Slc5a5 A T 8: 71,345,227 (GRCm39) S27T probably damaging Het
Slc7a14 A T 3: 31,277,595 (GRCm39) L670Q probably damaging Het
Snorc C T 1: 87,402,826 (GRCm39) T52I probably damaging Het
Stxbp4 A G 11: 90,426,267 (GRCm39) S514P unknown Het
Susd1 T A 4: 59,390,576 (GRCm39) T300S probably benign Het
Tecpr1 C T 5: 144,150,845 (GRCm39) probably benign Het
Tmem185b C T 1: 119,454,198 (GRCm39) probably benign Het
Tor2a T A 2: 32,651,699 (GRCm39) F305I probably damaging Het
Ttk T A 9: 83,750,113 (GRCm39) D689E probably damaging Het
Tut4 A T 4: 108,336,408 (GRCm39) D44V probably damaging Het
Usp25 A G 16: 76,878,421 (GRCm39) D615G probably damaging Het
Vmn1r209 A G 13: 22,990,684 (GRCm39) V2A probably benign Het
Vmn2r80 A C 10: 79,017,928 (GRCm39) E551A probably damaging Het
Wac G T 18: 7,926,104 (GRCm39) E636* probably null Het
Wdr53 T A 16: 32,071,130 (GRCm39) D158E probably damaging Het
Zbtb7c T C 18: 76,270,152 (GRCm39) V80A probably damaging Het
Other mutations in Sst
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1472:Sst UTSW 16 23,709,448 (GRCm39) missense probably benign
R1853:Sst UTSW 16 23,709,403 (GRCm39) missense probably damaging 1.00
R2209:Sst UTSW 16 23,708,558 (GRCm39) missense probably benign 0.05
R3919:Sst UTSW 16 23,708,591 (GRCm39) missense possibly damaging 0.59
R4350:Sst UTSW 16 23,708,565 (GRCm39) missense probably damaging 0.99
R4351:Sst UTSW 16 23,708,565 (GRCm39) missense probably damaging 0.99
R4352:Sst UTSW 16 23,708,565 (GRCm39) missense probably damaging 0.99
R5586:Sst UTSW 16 23,708,487 (GRCm39) missense probably damaging 1.00
R6844:Sst UTSW 16 23,708,592 (GRCm39) missense probably benign 0.00
R7492:Sst UTSW 16 23,708,576 (GRCm39) missense probably damaging 1.00
R9417:Sst UTSW 16 23,708,487 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGAAGTCAAACGCTTGCTCTTC -3'
(R):5'- TCACTGCCCTATCCAGGAAC -3'

Sequencing Primer
(F):5'- AGTCAAACGCTTGCTCTTCATAATC -3'
(R):5'- AGGAACTGGCCAAGTACTTCTTG -3'
Posted On 2021-08-02