Incidental Mutation 'R8904:Myo3b'
ID678355
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Namemyosin IIIB
SynonymsA430065P19Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8904 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location70039126-70429198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 70426908 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 1317 (H1317N)
Ref Sequence ENSEMBL: ENSMUSP00000055362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112243]
AlphaFold Q1EG27
Predicted Effect probably benign
Transcript: ENSMUST00000060208
AA Change: H1317N

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: H1317N

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112243
AA Change: H1289N

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: H1289N

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik CCGGAAGGGGAGGAGCAGTGACCCAGTTTCGGA CCGGA 16: 21,653,398 probably null Het
Adcy1 T G 11: 7,109,075 L327R probably damaging Het
Amotl1 T C 9: 14,558,565 Q624R probably damaging Het
Ampd1 A G 3: 103,081,058 T106A probably benign Het
Aqr T A 2: 114,136,993 I514F probably damaging Het
Atp2b1 A G 10: 98,969,004 T30A possibly damaging Het
Atp9a A T 2: 168,705,177 Y186N probably benign Het
Bub1 T A 2: 127,829,702 N21I possibly damaging Het
Cachd1 G A 4: 100,953,166 D322N probably damaging Het
Ccdc38 A G 10: 93,575,335 E402G probably damaging Het
Ccl27a A T 4: 41,774,194 probably null Het
Clic5 A T 17: 44,242,105 K82M probably benign Het
Cnot10 A T 9: 114,601,355 S566T probably benign Het
Cul9 T C 17: 46,520,501 T1596A probably damaging Het
Cyp2c55 A G 19: 39,034,372 E318G Het
Epb41l5 A G 1: 119,620,206 F156L probably damaging Het
Ephb4 T A 5: 137,370,805 M819K probably damaging Het
Esr1 A G 10: 4,746,654 R168G possibly damaging Het
Fbxw10 C A 11: 62,875,005 Y700* probably null Het
Fras1 G T 5: 96,781,279 R3847S probably benign Het
Gm11110 T C 17: 57,103,439 T20A unknown Het
Gm996 A T 2: 25,577,902 S666T probably benign Het
Gpr150 G T 13: 76,056,409 S139* probably null Het
Grm1 A T 10: 10,719,537 N782K probably damaging Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Hmcn2 A G 2: 31,433,392 S4173G possibly damaging Het
Hmx1 T A 5: 35,392,167 V268D probably damaging Het
Hsbp1l1 T C 18: 80,235,470 T33A possibly damaging Het
Hsd17b3 T C 13: 64,064,380 T161A probably damaging Het
Igll1 A T 16: 16,863,712 W60R probably benign Het
Itga11 A G 9: 62,757,611 T593A probably benign Het
Kat6a A G 8: 22,938,808 D1393G possibly damaging Het
Krt36 A G 11: 100,105,347 F84L probably benign Het
Macrod1 T C 19: 7,197,020 S266P probably damaging Het
Mib2 A G 4: 155,659,716 V163A probably damaging Het
Mpl A G 4: 118,444,066 L534P Het
Mut A G 17: 40,937,393 T104A probably damaging Het
Nkx2-6 A G 14: 69,171,971 D57G probably benign Het
Olfr1176 T G 2: 88,339,605 F13L possibly damaging Het
Olfr1449 T C 19: 12,934,828 V30A probably benign Het
Olfr374 A G 8: 72,110,432 I289V probably damaging Het
Olfr507 A G 7: 108,622,712 N300S probably damaging Het
Olfr750 A G 14: 51,071,208 Y62H probably damaging Het
Olfr853 A T 9: 19,537,464 D155E possibly damaging Het
Osbpl11 T A 16: 33,227,237 H523Q probably damaging Het
Pde1c A T 6: 56,179,143 S148T possibly damaging Het
Pign G A 1: 105,591,634 A521V possibly damaging Het
Pprc1 A G 19: 46,071,744 M1536V possibly damaging Het
Prg4 C A 1: 150,456,059 A288S possibly damaging Het
Prim2 A T 1: 33,630,432 I154N possibly damaging Het
Prkdc T C 16: 15,727,726 V1902A probably benign Het
Rgs22 A T 15: 36,025,981 C1056S probably damaging Het
Schip1 T C 3: 68,495,103 L199P possibly damaging Het
Sema4d A T 13: 51,700,899 L54* probably null Het
Sgsm1 C T 5: 113,273,629 G531R probably benign Het
Tas1r2 T C 4: 139,667,403 F519S probably damaging Het
Tnfsf11 C T 14: 78,278,679 R283Q possibly damaging Het
Tril C T 6: 53,820,217 V7M possibly damaging Het
Trim41 TTCCTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCCTCC 11: 48,816,257 probably benign Het
Tsr1 T A 11: 74,899,391 Y137* probably null Het
Ubr5 A G 15: 38,041,909 S148P Het
Zfp606 A G 7: 12,489,579 T64A possibly damaging Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 70105645 splice site probably benign
IGL00959:Myo3b APN 2 70314292 missense probably damaging 1.00
IGL01069:Myo3b APN 2 70245391 missense probably benign 0.22
IGL01116:Myo3b APN 2 70289386 missense probably damaging 1.00
IGL02097:Myo3b APN 2 70238829 missense probably damaging 1.00
IGL02220:Myo3b APN 2 70289579 splice site probably benign
IGL02553:Myo3b APN 2 70095224 missense probably benign 0.00
IGL02557:Myo3b APN 2 70255319 missense probably benign 0.16
IGL02648:Myo3b APN 2 70105372 splice site probably benign
IGL02902:Myo3b APN 2 70289401 missense probably benign 0.36
IGL02981:Myo3b APN 2 70108625 missense probably damaging 1.00
IGL03030:Myo3b APN 2 70426816 splice site probably benign
IGL03031:Myo3b APN 2 70255377 missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70426816 splice site probably benign
IGL03078:Myo3b APN 2 70286991 missense probably damaging 1.00
IGL03224:Myo3b APN 2 70349939 missense probably benign
IGL03329:Myo3b APN 2 70254459 missense probably damaging 1.00
R0079:Myo3b UTSW 2 70095158 missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70217166 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0313:Myo3b UTSW 2 70348959 nonsense probably null
R0331:Myo3b UTSW 2 70095261 missense probably damaging 1.00
R0371:Myo3b UTSW 2 70252960 splice site probably benign
R0442:Myo3b UTSW 2 70238961 critical splice donor site probably null
R0964:Myo3b UTSW 2 70426849 missense probably damaging 1.00
R1217:Myo3b UTSW 2 70330880 missense probably benign 0.02
R1429:Myo3b UTSW 2 70253007 missense probably damaging 0.97
R1460:Myo3b UTSW 2 70232454 missense probably benign 0.31
R1617:Myo3b UTSW 2 70281218 missense probably benign 0.00
R1628:Myo3b UTSW 2 70286962 missense probably benign 0.01
R1708:Myo3b UTSW 2 70245385 nonsense probably null
R1940:Myo3b UTSW 2 70258075 missense probably benign 0.01
R2407:Myo3b UTSW 2 70255253 missense probably damaging 1.00
R3081:Myo3b UTSW 2 70256583 splice site probably benign
R3687:Myo3b UTSW 2 70245314 missense probably benign
R3745:Myo3b UTSW 2 70234485 splice site probably benign
R4011:Myo3b UTSW 2 70096376 missense probably benign 0.15
R4074:Myo3b UTSW 2 70289464 missense probably damaging 1.00
R4419:Myo3b UTSW 2 70096362 missense probably damaging 1.00
R4496:Myo3b UTSW 2 70254404 missense probably benign
R4539:Myo3b UTSW 2 70039147 start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70238842 missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R4807:Myo3b UTSW 2 70105712 missense probably damaging 1.00
R4849:Myo3b UTSW 2 70244909 missense probably damaging 0.98
R4997:Myo3b UTSW 2 70258083 missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70258068 missense probably damaging 0.99
R5070:Myo3b UTSW 2 70253112 missense probably damaging 1.00
R5072:Myo3b UTSW 2 70095249 missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70258030 missense probably benign 0.01
R5103:Myo3b UTSW 2 70096403 missense probably benign 0.08
R5109:Myo3b UTSW 2 70095293 missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70426888 missense probably damaging 0.97
R5396:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R5400:Myo3b UTSW 2 70105380 missense probably damaging 1.00
R5468:Myo3b UTSW 2 70234441 missense probably benign 0.00
R5620:Myo3b UTSW 2 70238910 missense probably benign 0.04
R5646:Myo3b UTSW 2 70314430 missense probably damaging 0.97
R5729:Myo3b UTSW 2 70105739 missense probably damaging 1.00
R5943:Myo3b UTSW 2 70286941 missense probably benign 0.03
R5971:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70238769 missense probably benign 0.00
R6138:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70245410 critical splice donor site probably null
R6177:Myo3b UTSW 2 70313363 missense probably benign 0.00
R6421:Myo3b UTSW 2 70313356 missense probably benign 0.02
R6478:Myo3b UTSW 2 70348960 missense probably benign
R6606:Myo3b UTSW 2 70232485 missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70289512 missense probably damaging 1.00
R6982:Myo3b UTSW 2 70426065 missense probably benign 0.02
R6997:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R7032:Myo3b UTSW 2 70095264 missense probably damaging 0.98
R7038:Myo3b UTSW 2 70095208 missense probably benign 0.00
R7062:Myo3b UTSW 2 70217157 missense probably benign 0.00
R7537:Myo3b UTSW 2 70217169 missense probably benign 0.01
R7861:Myo3b UTSW 2 70108688 missense probably damaging 1.00
R7955:Myo3b UTSW 2 70095279 missense probably benign 0.37
R7977:Myo3b UTSW 2 70330933 missense probably benign
R7978:Myo3b UTSW 2 70253114 missense probably damaging 1.00
R7987:Myo3b UTSW 2 70330933 missense probably benign
R8803:Myo3b UTSW 2 70252994 missense probably benign
R8843:Myo3b UTSW 2 70257981 missense probably damaging 1.00
R8896:Myo3b UTSW 2 70238816 missense probably damaging 1.00
R8909:Myo3b UTSW 2 70253096 missense probably damaging 1.00
R9031:Myo3b UTSW 2 70251750 missense probably damaging 0.99
R9052:Myo3b UTSW 2 70232403 missense probably benign 0.00
U15987:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70232403 missense probably benign 0.00
X0065:Myo3b UTSW 2 70257969 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70096361 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70258027 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGACATTCAGAGCTGGGCAG -3'
(R):5'- GAATCTGTTGAGTTGTTCAGCAAG -3'

Sequencing Primer
(F):5'- AGGATGTAGCCCTGCCCAC -3'
(R):5'- TTCAGCAAGGTTTAGGGCCCAG -3'
Posted On2021-08-02