Incidental Mutation 'R8904:Aqr'
ID678357
Institutional Source Beutler Lab
Gene Symbol Aqr
Ensembl Gene ENSMUSG00000040383
Gene Nameaquarius
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8904 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location114101170-114187024 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 114136993 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 514 (I514F)
Ref Sequence ENSEMBL: ENSMUSP00000047157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043160] [ENSMUST00000102543]
Predicted Effect probably damaging
Transcript: ENSMUST00000043160
AA Change: I514F

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047157
Gene: ENSMUSG00000040383
AA Change: I514F

DomainStartEndE-ValueType
Pfam:Aquarius_N 18 802 N/A PFAM
Pfam:ResIII 797 911 8.2e-7 PFAM
Pfam:AAA_11 801 1111 9.6e-32 PFAM
Pfam:AAA_19 807 894 3.7e-11 PFAM
Pfam:AAA_12 1119 1312 2.1e-27 PFAM
low complexity region 1394 1417 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102543
AA Change: I514F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099602
Gene: ENSMUSG00000040383
AA Change: I514F

DomainStartEndE-ValueType
low complexity region 43 56 N/A INTRINSIC
low complexity region 112 124 N/A INTRINSIC
low complexity region 762 776 N/A INTRINSIC
Pfam:AAA_11 801 1111 3.2e-32 PFAM
Pfam:AAA_19 807 893 6.5e-11 PFAM
Pfam:AAA_12 1119 1312 2.6e-27 PFAM
low complexity region 1348 1359 N/A INTRINSIC
low complexity region 1371 1382 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik CCGGAAGGGGAGGAGCAGTGACCCAGTTTCGGA CCGGA 16: 21,653,398 probably null Het
Adcy1 T G 11: 7,109,075 L327R probably damaging Het
Amotl1 T C 9: 14,558,565 Q624R probably damaging Het
Ampd1 A G 3: 103,081,058 T106A probably benign Het
Atp2b1 A G 10: 98,969,004 T30A possibly damaging Het
Atp9a A T 2: 168,705,177 Y186N probably benign Het
Bub1 T A 2: 127,829,702 N21I possibly damaging Het
Cachd1 G A 4: 100,953,166 D322N probably damaging Het
Ccdc38 A G 10: 93,575,335 E402G probably damaging Het
Ccl27a A T 4: 41,774,194 probably null Het
Clic5 A T 17: 44,242,105 K82M probably benign Het
Cnot10 A T 9: 114,601,355 S566T probably benign Het
Cul9 T C 17: 46,520,501 T1596A probably damaging Het
Cyp2c55 A G 19: 39,034,372 E318G Het
Epb41l5 A G 1: 119,620,206 F156L probably damaging Het
Ephb4 T A 5: 137,370,805 M819K probably damaging Het
Esr1 A G 10: 4,746,654 R168G possibly damaging Het
Fbxw10 C A 11: 62,875,005 Y700* probably null Het
Fras1 G T 5: 96,781,279 R3847S probably benign Het
Gm11110 T C 17: 57,103,439 T20A unknown Het
Gm996 A T 2: 25,577,902 S666T probably benign Het
Gpr150 G T 13: 76,056,409 S139* probably null Het
Grm1 A T 10: 10,719,537 N782K probably damaging Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Hmcn2 A G 2: 31,433,392 S4173G possibly damaging Het
Hmx1 T A 5: 35,392,167 V268D probably damaging Het
Hsbp1l1 T C 18: 80,235,470 T33A possibly damaging Het
Hsd17b3 T C 13: 64,064,380 T161A probably damaging Het
Igll1 A T 16: 16,863,712 W60R probably benign Het
Itga11 A G 9: 62,757,611 T593A probably benign Het
Kat6a A G 8: 22,938,808 D1393G possibly damaging Het
Krt36 A G 11: 100,105,347 F84L probably benign Het
Macrod1 T C 19: 7,197,020 S266P probably damaging Het
Mib2 A G 4: 155,659,716 V163A probably damaging Het
Mpl A G 4: 118,444,066 L534P Het
Mut A G 17: 40,937,393 T104A probably damaging Het
Myo3b C A 2: 70,426,908 H1317N probably benign Het
Nkx2-6 A G 14: 69,171,971 D57G probably benign Het
Olfr1176 T G 2: 88,339,605 F13L possibly damaging Het
Olfr1449 T C 19: 12,934,828 V30A probably benign Het
Olfr374 A G 8: 72,110,432 I289V probably damaging Het
Olfr507 A G 7: 108,622,712 N300S probably damaging Het
Olfr750 A G 14: 51,071,208 Y62H probably damaging Het
Olfr853 A T 9: 19,537,464 D155E possibly damaging Het
Osbpl11 T A 16: 33,227,237 H523Q probably damaging Het
Pde1c A T 6: 56,179,143 S148T possibly damaging Het
Pign G A 1: 105,591,634 A521V possibly damaging Het
Pprc1 A G 19: 46,071,744 M1536V possibly damaging Het
Prg4 C A 1: 150,456,059 A288S possibly damaging Het
Prim2 A T 1: 33,630,432 I154N possibly damaging Het
Prkdc T C 16: 15,727,726 V1902A probably benign Het
Rgs22 A T 15: 36,025,981 C1056S probably damaging Het
Schip1 T C 3: 68,495,103 L199P possibly damaging Het
Sema4d A T 13: 51,700,899 L54* probably null Het
Sgsm1 C T 5: 113,273,629 G531R probably benign Het
Tas1r2 T C 4: 139,667,403 F519S probably damaging Het
Tnfsf11 C T 14: 78,278,679 R283Q possibly damaging Het
Tril C T 6: 53,820,217 V7M possibly damaging Het
Trim41 TTCCTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCCTCC 11: 48,816,257 probably benign Het
Tsr1 T A 11: 74,899,391 Y137* probably null Het
Ubr5 A G 15: 38,041,909 S148P Het
Zfp606 A G 7: 12,489,579 T64A possibly damaging Het
Other mutations in Aqr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Aqr APN 2 114125942 missense possibly damaging 0.90
IGL00694:Aqr APN 2 114151525 missense probably damaging 1.00
IGL02113:Aqr APN 2 114120027 nonsense probably null
IGL02297:Aqr APN 2 114150481 missense probably benign 0.24
IGL02380:Aqr APN 2 114109936 missense probably damaging 1.00
IGL02410:Aqr APN 2 114136917 missense possibly damaging 0.85
IGL02413:Aqr APN 2 114118780 missense possibly damaging 0.87
IGL02474:Aqr APN 2 114112646 missense probably damaging 1.00
IGL02941:Aqr APN 2 114113354 missense probably damaging 1.00
IGL02981:Aqr APN 2 114134824 splice site probably benign
IGL03001:Aqr APN 2 114146919 missense probably benign
IGL03092:Aqr APN 2 114158943 missense probably benign 0.38
IGL03222:Aqr APN 2 114121256 missense probably damaging 1.00
capricorn UTSW 2 114105882 missense probably damaging 1.00
Goat UTSW 2 114157575 missense probably damaging 1.00
Pliades UTSW 2 114132976 missense probably damaging 1.00
sagittarius UTSW 2 114149016 missense probably damaging 1.00
Zodiac UTSW 2 114108109 missense probably damaging 0.96
PIT4531001:Aqr UTSW 2 114130734 missense possibly damaging 0.94
R0103:Aqr UTSW 2 114149016 missense probably damaging 1.00
R0103:Aqr UTSW 2 114149016 missense probably damaging 1.00
R0152:Aqr UTSW 2 114159010 missense probably benign 0.07
R0352:Aqr UTSW 2 114170052 missense probably damaging 1.00
R0371:Aqr UTSW 2 114157604 missense possibly damaging 0.80
R0374:Aqr UTSW 2 114130611 missense probably damaging 1.00
R0550:Aqr UTSW 2 114132976 missense probably damaging 1.00
R0604:Aqr UTSW 2 114130604 missense probably benign 0.00
R0685:Aqr UTSW 2 114140977 missense probably damaging 1.00
R1236:Aqr UTSW 2 114116655 missense probably damaging 1.00
R1434:Aqr UTSW 2 114150409 missense probably damaging 1.00
R1806:Aqr UTSW 2 114161652 missense probably damaging 1.00
R2154:Aqr UTSW 2 114137004 missense probably damaging 1.00
R2185:Aqr UTSW 2 114130534 critical splice donor site probably null
R2377:Aqr UTSW 2 114140940 missense possibly damaging 0.58
R2862:Aqr UTSW 2 114136917 missense probably damaging 1.00
R3615:Aqr UTSW 2 114136887 missense probably damaging 1.00
R3616:Aqr UTSW 2 114136887 missense probably damaging 1.00
R3713:Aqr UTSW 2 114118669 splice site probably benign
R3715:Aqr UTSW 2 114118669 splice site probably benign
R4586:Aqr UTSW 2 114112577 missense probably benign 0.06
R4663:Aqr UTSW 2 114161666 nonsense probably null
R4809:Aqr UTSW 2 114175214 utr 5 prime probably benign
R4887:Aqr UTSW 2 114150509 missense probably damaging 1.00
R4888:Aqr UTSW 2 114150509 missense probably damaging 1.00
R4952:Aqr UTSW 2 114109937 missense probably damaging 1.00
R4974:Aqr UTSW 2 114113351 missense probably damaging 1.00
R5050:Aqr UTSW 2 114112609 nonsense probably null
R5050:Aqr UTSW 2 114170025 critical splice donor site probably null
R5213:Aqr UTSW 2 114113327 missense probably damaging 1.00
R5263:Aqr UTSW 2 114116578 missense probably damaging 1.00
R5470:Aqr UTSW 2 114157575 missense probably damaging 1.00
R5488:Aqr UTSW 2 114133073 missense probably damaging 1.00
R5489:Aqr UTSW 2 114133073 missense probably damaging 1.00
R5567:Aqr UTSW 2 114148970 missense probably damaging 1.00
R5570:Aqr UTSW 2 114148970 missense probably damaging 1.00
R5641:Aqr UTSW 2 114149034 missense probably damaging 1.00
R5685:Aqr UTSW 2 114156265 missense possibly damaging 0.87
R5963:Aqr UTSW 2 114126961 missense probably damaging 1.00
R5992:Aqr UTSW 2 114143049 nonsense probably null
R6015:Aqr UTSW 2 114175165 start codon destroyed probably null 0.53
R6253:Aqr UTSW 2 114156277 missense possibly damaging 0.93
R6264:Aqr UTSW 2 114109964 missense probably damaging 1.00
R6773:Aqr UTSW 2 114148996 missense possibly damaging 0.64
R6877:Aqr UTSW 2 114116571 nonsense probably null
R7211:Aqr UTSW 2 114134723 missense probably benign 0.01
R7232:Aqr UTSW 2 114105882 missense probably damaging 1.00
R7308:Aqr UTSW 2 114104062 missense possibly damaging 0.86
R7396:Aqr UTSW 2 114119946 nonsense probably null
R7490:Aqr UTSW 2 114158868 critical splice donor site probably null
R7526:Aqr UTSW 2 114108109 missense probably damaging 0.96
R7629:Aqr UTSW 2 114114593 missense probably damaging 1.00
R7828:Aqr UTSW 2 114149016 missense probably damaging 1.00
R8037:Aqr UTSW 2 114161680 missense probably damaging 1.00
R8166:Aqr UTSW 2 114113325 missense possibly damaging 0.95
R8712:Aqr UTSW 2 114118877 missense probably damaging 1.00
Z1176:Aqr UTSW 2 114108122 missense probably damaging 0.98
Z1176:Aqr UTSW 2 114109991 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- AGTACTCAACCAATGCTCTAAATG -3'
(R):5'- TGGAGATCCAGCCACTAGC -3'

Sequencing Primer
(F):5'- TGAAAAGCTATAAATCACAGAGGC -3'
(R):5'- TCATGTTCAGAGCAGCACTG -3'
Posted On2021-08-02