Mutagenetix > Incidental Mutation

Incidental Mutation 'R8904:Aqr'

678357

Institutional Source

Beutler Lab

Gene Symbol

Aqr

Ensembl Gene

ENSMUSG00000040383

Gene Name

aquarius

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8904 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

114101170-114187024 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 114136993 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 514 (I514F)

Ref Sequence

ENSEMBL: ENSMUSP00000047157 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043160] [ENSMUST00000102543]

AlphaFold

Q8CFQ3

Predicted Effect

probably damaging
Transcript: ENSMUST00000043160
AA Change: I514F

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000047157
Gene: ENSMUSG00000040383
AA Change: I514F

Domain	Start	End	E-Value	Type
Pfam:Aquarius_N	18	802	N/A	PFAM
Pfam:ResIII	797	911	8.2e-7	PFAM
Pfam:AAA_11	801	1111	9.6e-32	PFAM
Pfam:AAA_19	807	894	3.7e-11	PFAM
Pfam:AAA_12	1119	1312	2.1e-27	PFAM
low complexity region	1394	1417	N/A	INTRINSIC
low complexity region	1455	1468	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102543
AA Change: I514F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000099602
Gene: ENSMUSG00000040383
AA Change: I514F

Domain	Start	End	E-Value	Type
low complexity region	43	56	N/A	INTRINSIC
low complexity region	112	124	N/A	INTRINSIC
low complexity region	762	776	N/A	INTRINSIC
Pfam:AAA_11	801	1111	3.2e-32	PFAM
Pfam:AAA_19	807	893	6.5e-11	PFAM
Pfam:AAA_12	1119	1312	2.6e-27	PFAM
low complexity region	1348	1359	N/A	INTRINSIC
low complexity region	1371	1382	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

99% (66/67)

MGI Phenotype

PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510009E07Rik	CCGGAAGGGGAGGAGCAGTGACCCAGTTTCGGA	CCGGA	16: 21,653,398		probably null	Het
Adcy1	T	G	11: 7,109,075	L327R	probably damaging	Het
Amotl1	T	C	9: 14,558,565	Q624R	probably damaging	Het
Ampd1	A	G	3: 103,081,058	T106A	probably benign	Het
Atp2b1	A	G	10: 98,969,004	T30A	possibly damaging	Het
Atp9a	A	T	2: 168,705,177	Y186N	probably benign	Het
Bub1	T	A	2: 127,829,702	N21I	possibly damaging	Het
Cachd1	G	A	4: 100,953,166	D322N	probably damaging	Het
Ccdc38	A	G	10: 93,575,335	E402G	probably damaging	Het
Ccl27a	A	T	4: 41,774,194		probably null	Het
Clec4a4	T	C	6: 123,013,877		probably benign	Het
Clic5	A	T	17: 44,242,105	K82M	probably benign	Het
Cnot10	A	T	9: 114,601,355	S566T	probably benign	Het
Cul9	T	C	17: 46,520,501	T1596A	probably damaging	Het
Cyp2c55	A	G	19: 39,034,372	E318G		Het
Entpd8	A	C	2: 25,083,563		probably benign	Het
Epb41l5	A	G	1: 119,620,206	F156L	probably damaging	Het
Ephb4	T	A	5: 137,370,805	M819K	probably damaging	Het
Esr1	A	G	10: 4,746,654	R168G	possibly damaging	Het
Fbxw10	C	A	11: 62,875,005	Y700*	probably null	Het
Fras1	G	T	5: 96,781,279	R3847S	probably benign	Het
Gm11110	T	C	17: 57,103,439	T20A	unknown	Het
Gm996	A	T	2: 25,577,902	S666T	probably benign	Het
Gpr150	G	T	13: 76,056,409	S139*	probably null	Het
Grm1	A	T	10: 10,719,537	N782K	probably damaging	Het
Hmcn2	A	G	2: 31,433,392	S4173G	possibly damaging	Het
Hmx1	T	A	5: 35,392,167	V268D	probably damaging	Het
Hsbp1l1	T	C	18: 80,235,470	T33A	possibly damaging	Het
Hsd17b3	T	C	13: 64,064,380	T161A	probably damaging	Het
Igll1	A	T	16: 16,863,712	W60R	probably benign	Het
Itga11	A	G	9: 62,757,611	T593A	probably benign	Het
Kat6a	A	G	8: 22,938,808	D1393G	possibly damaging	Het
Krt36	A	G	11: 100,105,347	F84L	probably benign	Het
Macrod1	T	C	19: 7,197,020	S266P	probably damaging	Het
Mib2	A	G	4: 155,659,716	V163A	probably damaging	Het
Mpl	A	G	4: 118,444,066	L534P		Het
Mut	A	G	17: 40,937,393	T104A	probably damaging	Het
Myo3b	C	A	2: 70,426,908	H1317N	probably benign	Het
Nkx2-6	A	G	14: 69,171,971	D57G	probably benign	Het
Olfr1176	T	G	2: 88,339,605	F13L	possibly damaging	Het
Olfr1449	T	C	19: 12,934,828	V30A	probably benign	Het
Olfr374	A	G	8: 72,110,432	I289V	probably damaging	Het
Olfr507	A	G	7: 108,622,712	N300S	probably damaging	Het
Olfr750	A	G	14: 51,071,208	Y62H	probably damaging	Het
Olfr853	A	T	9: 19,537,464	D155E	possibly damaging	Het
Osbpl11	T	A	16: 33,227,237	H523Q	probably damaging	Het
Pde1c	A	T	6: 56,179,143	S148T	possibly damaging	Het
Pign	G	A	1: 105,591,634	A521V	possibly damaging	Het
Pprc1	A	G	19: 46,071,744	M1536V	possibly damaging	Het
Prg4	C	A	1: 150,456,059	A288S	possibly damaging	Het
Prim2	A	T	1: 33,630,432	I154N	possibly damaging	Het
Prkdc	T	C	16: 15,727,726	V1902A	probably benign	Het
Prss40	C	T	1: 34,555,964		probably benign	Het
Ret	C	T	6: 118,180,213		probably benign	Het
Rgs22	A	T	15: 36,025,981	C1056S	probably damaging	Het
Schip1	T	C	3: 68,495,103	L199P	possibly damaging	Het
Sema4d	A	T	13: 51,700,899	L54*	probably null	Het
Sgsm1	C	T	5: 113,273,629	G531R	probably benign	Het
Tas1r2	T	C	4: 139,667,403	F519S	probably damaging	Het
Tnfsf11	C	T	14: 78,278,679	R283Q	possibly damaging	Het
Tril	C	T	6: 53,820,217	V7M	possibly damaging	Het
Tsr1	T	A	11: 74,899,391	Y137*	probably null	Het
Ubr5	A	G	15: 38,041,909	S148P		Het
Unc13b	A	G	4: 43,178,531		probably benign	Het
Zfp606	A	G	7: 12,489,579	T64A	possibly damaging	Het

Other mutations in Aqr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Aqr	APN	2	114125942	missense	possibly damaging	0.90
IGL00694:Aqr	APN	2	114151525	missense	probably damaging	1.00
IGL02113:Aqr	APN	2	114120027	nonsense	probably null
IGL02297:Aqr	APN	2	114150481	missense	probably benign	0.24
IGL02380:Aqr	APN	2	114109936	missense	probably damaging	1.00
IGL02410:Aqr	APN	2	114136917	missense	possibly damaging	0.85
IGL02413:Aqr	APN	2	114118780	missense	possibly damaging	0.87
IGL02474:Aqr	APN	2	114112646	missense	probably damaging	1.00
IGL02941:Aqr	APN	2	114113354	missense	probably damaging	1.00
IGL02981:Aqr	APN	2	114134824	splice site	probably benign
IGL03001:Aqr	APN	2	114146919	missense	probably benign
IGL03092:Aqr	APN	2	114158943	missense	probably benign	0.38
IGL03222:Aqr	APN	2	114121256	missense	probably damaging	1.00
capricorn	UTSW	2	114105882	missense	probably damaging	1.00
Goat	UTSW	2	114157575	missense	probably damaging	1.00
Pliades	UTSW	2	114132976	missense	probably damaging	1.00
sagittarius	UTSW	2	114149016	missense	probably damaging	1.00
Zodiac	UTSW	2	114108109	missense	probably damaging	0.96
PIT4531001:Aqr	UTSW	2	114130734	missense	possibly damaging	0.94
R0103:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R0103:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R0152:Aqr	UTSW	2	114159010	missense	probably benign	0.07
R0352:Aqr	UTSW	2	114170052	missense	probably damaging	1.00
R0371:Aqr	UTSW	2	114157604	missense	possibly damaging	0.80
R0374:Aqr	UTSW	2	114130611	missense	probably damaging	1.00
R0550:Aqr	UTSW	2	114132976	missense	probably damaging	1.00
R0604:Aqr	UTSW	2	114130604	missense	probably benign	0.00
R0685:Aqr	UTSW	2	114140977	missense	probably damaging	1.00
R1236:Aqr	UTSW	2	114116655	missense	probably damaging	1.00
R1434:Aqr	UTSW	2	114150409	missense	probably damaging	1.00
R1806:Aqr	UTSW	2	114161652	missense	probably damaging	1.00
R2154:Aqr	UTSW	2	114137004	missense	probably damaging	1.00
R2185:Aqr	UTSW	2	114130534	critical splice donor site	probably null
R2377:Aqr	UTSW	2	114140940	missense	possibly damaging	0.58
R2862:Aqr	UTSW	2	114136917	missense	probably damaging	1.00
R3615:Aqr	UTSW	2	114136887	missense	probably damaging	1.00
R3616:Aqr	UTSW	2	114136887	missense	probably damaging	1.00
R3713:Aqr	UTSW	2	114118669	splice site	probably benign
R3715:Aqr	UTSW	2	114118669	splice site	probably benign
R4586:Aqr	UTSW	2	114112577	missense	probably benign	0.06
R4663:Aqr	UTSW	2	114161666	nonsense	probably null
R4809:Aqr	UTSW	2	114175214	utr 5 prime	probably benign
R4887:Aqr	UTSW	2	114150509	missense	probably damaging	1.00
R4888:Aqr	UTSW	2	114150509	missense	probably damaging	1.00
R4952:Aqr	UTSW	2	114109937	missense	probably damaging	1.00
R4974:Aqr	UTSW	2	114113351	missense	probably damaging	1.00
R5050:Aqr	UTSW	2	114112609	nonsense	probably null
R5050:Aqr	UTSW	2	114170025	critical splice donor site	probably null
R5213:Aqr	UTSW	2	114113327	missense	probably damaging	1.00
R5263:Aqr	UTSW	2	114116578	missense	probably damaging	1.00
R5470:Aqr	UTSW	2	114157575	missense	probably damaging	1.00
R5488:Aqr	UTSW	2	114133073	missense	probably damaging	1.00
R5489:Aqr	UTSW	2	114133073	missense	probably damaging	1.00
R5567:Aqr	UTSW	2	114148970	missense	probably damaging	1.00
R5570:Aqr	UTSW	2	114148970	missense	probably damaging	1.00
R5641:Aqr	UTSW	2	114149034	missense	probably damaging	1.00
R5685:Aqr	UTSW	2	114156265	missense	possibly damaging	0.87
R5963:Aqr	UTSW	2	114126961	missense	probably damaging	1.00
R5992:Aqr	UTSW	2	114143049	nonsense	probably null
R6015:Aqr	UTSW	2	114175165	start codon destroyed	probably null	0.53
R6253:Aqr	UTSW	2	114156277	missense	possibly damaging	0.93
R6264:Aqr	UTSW	2	114109964	missense	probably damaging	1.00
R6773:Aqr	UTSW	2	114148996	missense	possibly damaging	0.64
R6877:Aqr	UTSW	2	114116571	nonsense	probably null
R7211:Aqr	UTSW	2	114134723	missense	probably benign	0.01
R7232:Aqr	UTSW	2	114105882	missense	probably damaging	1.00
R7308:Aqr	UTSW	2	114104062	missense	possibly damaging	0.86
R7396:Aqr	UTSW	2	114119946	nonsense	probably null
R7490:Aqr	UTSW	2	114158868	critical splice donor site	probably null
R7526:Aqr	UTSW	2	114108109	missense	probably damaging	0.96
R7629:Aqr	UTSW	2	114114593	missense	probably damaging	1.00
R7828:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R8037:Aqr	UTSW	2	114161680	missense	probably damaging	1.00
R8166:Aqr	UTSW	2	114113325	missense	possibly damaging	0.95
R8712:Aqr	UTSW	2	114118877	missense	probably damaging	1.00
R9487:Aqr	UTSW	2	114104047	missense	probably benign	0.04
R9527:Aqr	UTSW	2	114101556	missense	probably benign	0.02
R9664:Aqr	UTSW	2	114140915	nonsense	probably null
Z1176:Aqr	UTSW	2	114108122	missense	probably damaging	0.98
Z1176:Aqr	UTSW	2	114109991	missense	probably benign	0.25

Predicted Primers

PCR Primer
(F):5'- AGTACTCAACCAATGCTCTAAATG -3'
(R):5'- TGGAGATCCAGCCACTAGC -3'

Sequencing Primer
(F):5'- TGAAAAGCTATAAATCACAGAGGC -3'
(R):5'- TCATGTTCAGAGCAGCACTG -3'

Posted On

2021-08-02