Mutagenetix > Incidental Mutation

Incidental Mutation 'R8904:Ephb4'

678370

Institutional Source

Beutler Lab

Gene Symbol

Ephb4

Ensembl Gene

ENSMUSG00000029710

Gene Name

Eph receptor B4

Synonyms

MDK2, Htk, Myk1, Tyro11

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8904 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

137350109-137378669 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 137370805 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 819 (M819K)

Ref Sequence

ENSEMBL: ENSMUSP00000106684 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061244] [ENSMUST00000111054] [ENSMUST00000111055] [ENSMUST00000144296] [ENSMUST00000166239]

AlphaFold

P54761

Predicted Effect

probably damaging
Transcript: ENSMUST00000061244
AA Change: M810K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000051622
Gene: ENSMUSG00000029710
AA Change: M810K

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	2.6e-11	PFAM
FN3	324	413	1.75e-6	SMART
FN3	434	516	1.07e-10	SMART
Pfam:EphA2_TM	540	612	8.9e-26	PFAM
TyrKc	615	874	5.09e-130	SMART
SAM	904	971	2.44e-21	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000111054
AA Change: M810K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000106683
Gene: ENSMUSG00000029710
AA Change: M810K

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	1.4e-11	PFAM
FN3	324	413	1.75e-6	SMART
FN3	434	516	1.07e-10	SMART
Pfam:EphA2_TM	540	612	3.4e-26	PFAM
TyrKc	615	874	5.09e-130	SMART
Pfam:SAM_1	882	917	2.6e-7	PFAM
low complexity region	919	934	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111055
AA Change: M819K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000106684
Gene: ENSMUSG00000029710
AA Change: M819K

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	4.2e-10	PFAM
FN3	324	413	1.75e-6	SMART
FN3	443	525	1.07e-10	SMART
Pfam:EphA2_TM	550	621	5e-24	PFAM
TyrKc	624	883	5.09e-130	SMART
SAM	913	980	2.44e-21	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000144296
AA Change: M810K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000115731
Gene: ENSMUSG00000029710
AA Change: M810K

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	2.6e-11	PFAM
FN3	324	413	1.75e-6	SMART
FN3	434	516	1.07e-10	SMART
Pfam:EphA2_TM	540	612	8.9e-26	PFAM
TyrKc	615	874	5.09e-130	SMART
SAM	904	971	2.44e-21	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000166239
AA Change: M810K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000130275
Gene: ENSMUSG00000029710
AA Change: M810K

Domain	Start	End	E-Value	Type
EPH_lbd	17	197	6.3e-106	SMART
Pfam:GCC2_GCC3	258	301	2.6e-11	PFAM
FN3	324	413	1.75e-6	SMART
FN3	434	516	1.07e-10	SMART
Pfam:EphA2_TM	540	612	8.9e-26	PFAM
TyrKc	615	874	5.09e-130	SMART
SAM	904	971	2.44e-21	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

99% (66/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene binds to ephrin-B2 and plays an essential role in vascular development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit arrested angiogenesis and heart development and midgestational lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510009E07Rik	CCGGAAGGGGAGGAGCAGTGACCCAGTTTCGGA	CCGGA	16: 21,653,398		probably null	Het
Adcy1	T	G	11: 7,109,075	L327R	probably damaging	Het
Amotl1	T	C	9: 14,558,565	Q624R	probably damaging	Het
Ampd1	A	G	3: 103,081,058	T106A	probably benign	Het
Aqr	T	A	2: 114,136,993	I514F	probably damaging	Het
Atp2b1	A	G	10: 98,969,004	T30A	possibly damaging	Het
Atp9a	A	T	2: 168,705,177	Y186N	probably benign	Het
Bub1	T	A	2: 127,829,702	N21I	possibly damaging	Het
Cachd1	G	A	4: 100,953,166	D322N	probably damaging	Het
Ccdc38	A	G	10: 93,575,335	E402G	probably damaging	Het
Ccl27a	A	T	4: 41,774,194		probably null	Het
Clec4a4	T	C	6: 123,013,877		probably benign	Het
Clic5	A	T	17: 44,242,105	K82M	probably benign	Het
Cnot10	A	T	9: 114,601,355	S566T	probably benign	Het
Cul9	T	C	17: 46,520,501	T1596A	probably damaging	Het
Cyp2c55	A	G	19: 39,034,372	E318G		Het
Entpd8	A	C	2: 25,083,563		probably benign	Het
Epb41l5	A	G	1: 119,620,206	F156L	probably damaging	Het
Esr1	A	G	10: 4,746,654	R168G	possibly damaging	Het
Fbxw10	C	A	11: 62,875,005	Y700*	probably null	Het
Fras1	G	T	5: 96,781,279	R3847S	probably benign	Het
Gm11110	T	C	17: 57,103,439	T20A	unknown	Het
Gm996	A	T	2: 25,577,902	S666T	probably benign	Het
Gpr150	G	T	13: 76,056,409	S139*	probably null	Het
Grm1	A	T	10: 10,719,537	N782K	probably damaging	Het
Hmcn2	A	G	2: 31,433,392	S4173G	possibly damaging	Het
Hmx1	T	A	5: 35,392,167	V268D	probably damaging	Het
Hsbp1l1	T	C	18: 80,235,470	T33A	possibly damaging	Het
Hsd17b3	T	C	13: 64,064,380	T161A	probably damaging	Het
Igll1	A	T	16: 16,863,712	W60R	probably benign	Het
Itga11	A	G	9: 62,757,611	T593A	probably benign	Het
Kat6a	A	G	8: 22,938,808	D1393G	possibly damaging	Het
Krt36	A	G	11: 100,105,347	F84L	probably benign	Het
Macrod1	T	C	19: 7,197,020	S266P	probably damaging	Het
Mib2	A	G	4: 155,659,716	V163A	probably damaging	Het
Mpl	A	G	4: 118,444,066	L534P		Het
Mut	A	G	17: 40,937,393	T104A	probably damaging	Het
Myo3b	C	A	2: 70,426,908	H1317N	probably benign	Het
Nkx2-6	A	G	14: 69,171,971	D57G	probably benign	Het
Olfr1176	T	G	2: 88,339,605	F13L	possibly damaging	Het
Olfr1449	T	C	19: 12,934,828	V30A	probably benign	Het
Olfr374	A	G	8: 72,110,432	I289V	probably damaging	Het
Olfr507	A	G	7: 108,622,712	N300S	probably damaging	Het
Olfr750	A	G	14: 51,071,208	Y62H	probably damaging	Het
Olfr853	A	T	9: 19,537,464	D155E	possibly damaging	Het
Osbpl11	T	A	16: 33,227,237	H523Q	probably damaging	Het
Pde1c	A	T	6: 56,179,143	S148T	possibly damaging	Het
Pign	G	A	1: 105,591,634	A521V	possibly damaging	Het
Pprc1	A	G	19: 46,071,744	M1536V	possibly damaging	Het
Prg4	C	A	1: 150,456,059	A288S	possibly damaging	Het
Prim2	A	T	1: 33,630,432	I154N	possibly damaging	Het
Prkdc	T	C	16: 15,727,726	V1902A	probably benign	Het
Prss40	C	T	1: 34,555,964		probably benign	Het
Ret	C	T	6: 118,180,213		probably benign	Het
Rgs22	A	T	15: 36,025,981	C1056S	probably damaging	Het
Schip1	T	C	3: 68,495,103	L199P	possibly damaging	Het
Sema4d	A	T	13: 51,700,899	L54*	probably null	Het
Sgsm1	C	T	5: 113,273,629	G531R	probably benign	Het
Tas1r2	T	C	4: 139,667,403	F519S	probably damaging	Het
Tnfsf11	C	T	14: 78,278,679	R283Q	possibly damaging	Het
Tril	C	T	6: 53,820,217	V7M	possibly damaging	Het
Tsr1	T	A	11: 74,899,391	Y137*	probably null	Het
Ubr5	A	G	15: 38,041,909	S148P		Het
Unc13b	A	G	4: 43,178,531		probably benign	Het
Zfp606	A	G	7: 12,489,579	T64A	possibly damaging	Het

Other mutations in Ephb4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00542:Ephb4	APN	5	137365615	splice site	probably benign
IGL00948:Ephb4	APN	5	137366659	missense	probably damaging	1.00
IGL01653:Ephb4	APN	5	137365741	splice site	probably benign
IGL01885:Ephb4	APN	5	137357797	missense	probably damaging	1.00
IGL01906:Ephb4	APN	5	137361194	missense	probably damaging	1.00
IGL02089:Ephb4	APN	5	137370762	missense	probably damaging	0.98
IGL02216:Ephb4	APN	5	137372070	missense	possibly damaging	0.92
IGL02233:Ephb4	APN	5	137354501	nonsense	probably null
IGL03080:Ephb4	APN	5	137354083	splice site	probably benign
IGL03111:Ephb4	APN	5	137372505	missense	probably benign	0.07
R0599:Ephb4	UTSW	5	137369855	missense	probably damaging	1.00
R0744:Ephb4	UTSW	5	137365667	missense	probably damaging	1.00
R1331:Ephb4	UTSW	5	137366534	splice site	probably benign
R1441:Ephb4	UTSW	5	137361247	missense	probably damaging	1.00
R1732:Ephb4	UTSW	5	137372178	missense	possibly damaging	0.93
R1745:Ephb4	UTSW	5	137360434	missense	probably benign
R1831:Ephb4	UTSW	5	137354415	missense	probably damaging	1.00
R1865:Ephb4	UTSW	5	137363310	missense	possibly damaging	0.53
R2165:Ephb4	UTSW	5	137354426	missense	probably benign	0.08
R2206:Ephb4	UTSW	5	137357719	missense	probably damaging	1.00
R2473:Ephb4	UTSW	5	137365700	missense	probably benign	0.15
R4779:Ephb4	UTSW	5	137365702	missense	probably benign	0.04
R4801:Ephb4	UTSW	5	137365506	missense	probably damaging	1.00
R4802:Ephb4	UTSW	5	137365506	missense	probably damaging	1.00
R5307:Ephb4	UTSW	5	137363312	missense	probably damaging	1.00
R5452:Ephb4	UTSW	5	137361142	missense	probably damaging	1.00
R5458:Ephb4	UTSW	5	137369852	missense	probably damaging	1.00
R5475:Ephb4	UTSW	5	137354439	missense	probably benign	0.00
R5662:Ephb4	UTSW	5	137372195	missense	probably damaging	0.98
R5879:Ephb4	UTSW	5	137360416	missense	probably benign	0.00
R6336:Ephb4	UTSW	5	137372085	missense	probably damaging	1.00
R6443:Ephb4	UTSW	5	137360449	missense	probably damaging	1.00
R6632:Ephb4	UTSW	5	137366587	missense	probably damaging	0.99
R6973:Ephb4	UTSW	5	137369804	missense	probably damaging	1.00
R7008:Ephb4	UTSW	5	137361274	missense	probably benign	0.00
R7145:Ephb4	UTSW	5	137372046	missense	probably damaging	1.00
R7421:Ephb4	UTSW	5	137354425	missense	possibly damaging	0.88
R7593:Ephb4	UTSW	5	137361298	missense	probably benign
R7635:Ephb4	UTSW	5	137372103	missense	probably damaging	1.00
R7751:Ephb4	UTSW	5	137365675	missense	probably damaging	1.00
R7825:Ephb4	UTSW	5	137372437	missense	probably damaging	1.00
R8539:Ephb4	UTSW	5	137357855	missense	probably damaging	1.00
R9228:Ephb4	UTSW	5	137354562	missense	possibly damaging	0.79
R9327:Ephb4	UTSW	5	137363267	missense	probably damaging	0.99
R9513:Ephb4	UTSW	5	137363302	missense	possibly damaging	0.76
R9659:Ephb4	UTSW	5	137365481	missense	probably damaging	1.00
R9788:Ephb4	UTSW	5	137365481	missense	probably damaging	1.00
X0026:Ephb4	UTSW	5	137373558	missense	probably damaging	1.00
Z1177:Ephb4	UTSW	5	137361359	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CCGGGAGTTAGGGCAGTT -3'
(R):5'- CACACAGATGGGGAAAGAGTCT -3'

Sequencing Primer
(F):5'- AGGCCCGTCCTTTAAGAGTCTAG -3'
(R):5'- GAAAGAGTCTGGGAACTCTATCC -3'

Posted On

2021-08-02