Incidental Mutation 'R8904:Ephb4'
ID 678370
Institutional Source Beutler Lab
Gene Symbol Ephb4
Ensembl Gene ENSMUSG00000029710
Gene Name Eph receptor B4
Synonyms MDK2, Htk, Myk1, Tyro11
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8904 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 137350109-137378669 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 137370805 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 819 (M819K)
Ref Sequence ENSEMBL: ENSMUSP00000106684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061244] [ENSMUST00000111054] [ENSMUST00000111055] [ENSMUST00000144296] [ENSMUST00000166239]
AlphaFold P54761
Predicted Effect probably damaging
Transcript: ENSMUST00000061244
AA Change: M810K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051622
Gene: ENSMUSG00000029710
AA Change: M810K

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111054
AA Change: M810K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106683
Gene: ENSMUSG00000029710
AA Change: M810K

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 1.4e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 3.4e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
Pfam:SAM_1 882 917 2.6e-7 PFAM
low complexity region 919 934 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111055
AA Change: M819K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106684
Gene: ENSMUSG00000029710
AA Change: M819K

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 4.2e-10 PFAM
FN3 324 413 1.75e-6 SMART
FN3 443 525 1.07e-10 SMART
Pfam:EphA2_TM 550 621 5e-24 PFAM
TyrKc 624 883 5.09e-130 SMART
SAM 913 980 2.44e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000144296
AA Change: M810K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115731
Gene: ENSMUSG00000029710
AA Change: M810K

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000166239
AA Change: M810K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130275
Gene: ENSMUSG00000029710
AA Change: M810K

DomainStartEndE-ValueType
EPH_lbd 17 197 6.3e-106 SMART
Pfam:GCC2_GCC3 258 301 2.6e-11 PFAM
FN3 324 413 1.75e-6 SMART
FN3 434 516 1.07e-10 SMART
Pfam:EphA2_TM 540 612 8.9e-26 PFAM
TyrKc 615 874 5.09e-130 SMART
SAM 904 971 2.44e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene binds to ephrin-B2 and plays an essential role in vascular development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit arrested angiogenesis and heart development and midgestational lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik CCGGAAGGGGAGGAGCAGTGACCCAGTTTCGGA CCGGA 16: 21,653,398 probably null Het
Adcy1 T G 11: 7,109,075 L327R probably damaging Het
Amotl1 T C 9: 14,558,565 Q624R probably damaging Het
Ampd1 A G 3: 103,081,058 T106A probably benign Het
Aqr T A 2: 114,136,993 I514F probably damaging Het
Atp2b1 A G 10: 98,969,004 T30A possibly damaging Het
Atp9a A T 2: 168,705,177 Y186N probably benign Het
Bub1 T A 2: 127,829,702 N21I possibly damaging Het
Cachd1 G A 4: 100,953,166 D322N probably damaging Het
Ccdc38 A G 10: 93,575,335 E402G probably damaging Het
Ccl27a A T 4: 41,774,194 probably null Het
Clec4a4 T C 6: 123,013,877 probably benign Het
Clic5 A T 17: 44,242,105 K82M probably benign Het
Cnot10 A T 9: 114,601,355 S566T probably benign Het
Cul9 T C 17: 46,520,501 T1596A probably damaging Het
Cyp2c55 A G 19: 39,034,372 E318G Het
Entpd8 A C 2: 25,083,563 probably benign Het
Epb41l5 A G 1: 119,620,206 F156L probably damaging Het
Esr1 A G 10: 4,746,654 R168G possibly damaging Het
Fbxw10 C A 11: 62,875,005 Y700* probably null Het
Fras1 G T 5: 96,781,279 R3847S probably benign Het
Gm11110 T C 17: 57,103,439 T20A unknown Het
Gm996 A T 2: 25,577,902 S666T probably benign Het
Gpr150 G T 13: 76,056,409 S139* probably null Het
Grm1 A T 10: 10,719,537 N782K probably damaging Het
Hmcn2 A G 2: 31,433,392 S4173G possibly damaging Het
Hmx1 T A 5: 35,392,167 V268D probably damaging Het
Hsbp1l1 T C 18: 80,235,470 T33A possibly damaging Het
Hsd17b3 T C 13: 64,064,380 T161A probably damaging Het
Igll1 A T 16: 16,863,712 W60R probably benign Het
Itga11 A G 9: 62,757,611 T593A probably benign Het
Kat6a A G 8: 22,938,808 D1393G possibly damaging Het
Krt36 A G 11: 100,105,347 F84L probably benign Het
Macrod1 T C 19: 7,197,020 S266P probably damaging Het
Mib2 A G 4: 155,659,716 V163A probably damaging Het
Mpl A G 4: 118,444,066 L534P Het
Mut A G 17: 40,937,393 T104A probably damaging Het
Myo3b C A 2: 70,426,908 H1317N probably benign Het
Nkx2-6 A G 14: 69,171,971 D57G probably benign Het
Olfr1176 T G 2: 88,339,605 F13L possibly damaging Het
Olfr1449 T C 19: 12,934,828 V30A probably benign Het
Olfr374 A G 8: 72,110,432 I289V probably damaging Het
Olfr507 A G 7: 108,622,712 N300S probably damaging Het
Olfr750 A G 14: 51,071,208 Y62H probably damaging Het
Olfr853 A T 9: 19,537,464 D155E possibly damaging Het
Osbpl11 T A 16: 33,227,237 H523Q probably damaging Het
Pde1c A T 6: 56,179,143 S148T possibly damaging Het
Pign G A 1: 105,591,634 A521V possibly damaging Het
Pprc1 A G 19: 46,071,744 M1536V possibly damaging Het
Prg4 C A 1: 150,456,059 A288S possibly damaging Het
Prim2 A T 1: 33,630,432 I154N possibly damaging Het
Prkdc T C 16: 15,727,726 V1902A probably benign Het
Prss40 C T 1: 34,555,964 probably benign Het
Ret C T 6: 118,180,213 probably benign Het
Rgs22 A T 15: 36,025,981 C1056S probably damaging Het
Schip1 T C 3: 68,495,103 L199P possibly damaging Het
Sema4d A T 13: 51,700,899 L54* probably null Het
Sgsm1 C T 5: 113,273,629 G531R probably benign Het
Tas1r2 T C 4: 139,667,403 F519S probably damaging Het
Tnfsf11 C T 14: 78,278,679 R283Q possibly damaging Het
Tril C T 6: 53,820,217 V7M possibly damaging Het
Tsr1 T A 11: 74,899,391 Y137* probably null Het
Ubr5 A G 15: 38,041,909 S148P Het
Unc13b A G 4: 43,178,531 probably benign Het
Zfp606 A G 7: 12,489,579 T64A possibly damaging Het
Other mutations in Ephb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00542:Ephb4 APN 5 137365615 splice site probably benign
IGL00948:Ephb4 APN 5 137366659 missense probably damaging 1.00
IGL01653:Ephb4 APN 5 137365741 splice site probably benign
IGL01885:Ephb4 APN 5 137357797 missense probably damaging 1.00
IGL01906:Ephb4 APN 5 137361194 missense probably damaging 1.00
IGL02089:Ephb4 APN 5 137370762 missense probably damaging 0.98
IGL02216:Ephb4 APN 5 137372070 missense possibly damaging 0.92
IGL02233:Ephb4 APN 5 137354501 nonsense probably null
IGL03080:Ephb4 APN 5 137354083 splice site probably benign
IGL03111:Ephb4 APN 5 137372505 missense probably benign 0.07
R0599:Ephb4 UTSW 5 137369855 missense probably damaging 1.00
R0744:Ephb4 UTSW 5 137365667 missense probably damaging 1.00
R1331:Ephb4 UTSW 5 137366534 splice site probably benign
R1441:Ephb4 UTSW 5 137361247 missense probably damaging 1.00
R1732:Ephb4 UTSW 5 137372178 missense possibly damaging 0.93
R1745:Ephb4 UTSW 5 137360434 missense probably benign
R1831:Ephb4 UTSW 5 137354415 missense probably damaging 1.00
R1865:Ephb4 UTSW 5 137363310 missense possibly damaging 0.53
R2165:Ephb4 UTSW 5 137354426 missense probably benign 0.08
R2206:Ephb4 UTSW 5 137357719 missense probably damaging 1.00
R2473:Ephb4 UTSW 5 137365700 missense probably benign 0.15
R4779:Ephb4 UTSW 5 137365702 missense probably benign 0.04
R4801:Ephb4 UTSW 5 137365506 missense probably damaging 1.00
R4802:Ephb4 UTSW 5 137365506 missense probably damaging 1.00
R5307:Ephb4 UTSW 5 137363312 missense probably damaging 1.00
R5452:Ephb4 UTSW 5 137361142 missense probably damaging 1.00
R5458:Ephb4 UTSW 5 137369852 missense probably damaging 1.00
R5475:Ephb4 UTSW 5 137354439 missense probably benign 0.00
R5662:Ephb4 UTSW 5 137372195 missense probably damaging 0.98
R5879:Ephb4 UTSW 5 137360416 missense probably benign 0.00
R6336:Ephb4 UTSW 5 137372085 missense probably damaging 1.00
R6443:Ephb4 UTSW 5 137360449 missense probably damaging 1.00
R6632:Ephb4 UTSW 5 137366587 missense probably damaging 0.99
R6973:Ephb4 UTSW 5 137369804 missense probably damaging 1.00
R7008:Ephb4 UTSW 5 137361274 missense probably benign 0.00
R7145:Ephb4 UTSW 5 137372046 missense probably damaging 1.00
R7421:Ephb4 UTSW 5 137354425 missense possibly damaging 0.88
R7593:Ephb4 UTSW 5 137361298 missense probably benign
R7635:Ephb4 UTSW 5 137372103 missense probably damaging 1.00
R7751:Ephb4 UTSW 5 137365675 missense probably damaging 1.00
R7825:Ephb4 UTSW 5 137372437 missense probably damaging 1.00
R8539:Ephb4 UTSW 5 137357855 missense probably damaging 1.00
R9228:Ephb4 UTSW 5 137354562 missense possibly damaging 0.79
R9327:Ephb4 UTSW 5 137363267 missense probably damaging 0.99
R9513:Ephb4 UTSW 5 137363302 missense possibly damaging 0.76
R9659:Ephb4 UTSW 5 137365481 missense probably damaging 1.00
R9788:Ephb4 UTSW 5 137365481 missense probably damaging 1.00
X0026:Ephb4 UTSW 5 137373558 missense probably damaging 1.00
Z1177:Ephb4 UTSW 5 137361359 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCGGGAGTTAGGGCAGTT -3'
(R):5'- CACACAGATGGGGAAAGAGTCT -3'

Sequencing Primer
(F):5'- AGGCCCGTCCTTTAAGAGTCTAG -3'
(R):5'- GAAAGAGTCTGGGAACTCTATCC -3'
Posted On 2021-08-02