Incidental Mutation 'R8904:Hsd17b3'
ID 678391
Institutional Source Beutler Lab
Gene Symbol Hsd17b3
Ensembl Gene ENSMUSG00000033122
Gene Name hydroxysteroid (17-beta) dehydrogenase 3
Synonyms 17(beta)HSD type 3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8904 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 64058266-64089230 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 64064380 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 161 (T161A)
Ref Sequence ENSEMBL: ENSMUSP00000044217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039832] [ENSMUST00000166224] [ENSMUST00000222783] [ENSMUST00000222810]
AlphaFold P70385
Predicted Effect probably damaging
Transcript: ENSMUST00000039832
AA Change: T161A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000044217
Gene: ENSMUSG00000033122
AA Change: T161A

DomainStartEndE-ValueType
Pfam:adh_short 45 213 3.4e-26 PFAM
Pfam:adh_short_C2 51 272 1.2e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166224
AA Change: T161A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132011
Gene: ENSMUSG00000033122
AA Change: T161A

DomainStartEndE-ValueType
Pfam:adh_short 45 240 2.4e-48 PFAM
Pfam:adh_short_C2 51 272 3.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221513
Predicted Effect probably damaging
Transcript: ENSMUST00000222783
AA Change: T161A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000222810
AA Change: T161A

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This isoform of 17 beta-hydroxysteroid dehydrogenase is expressed predominantly in the testis and catalyzes the conversion of androstenedione to testosterone. It preferentially uses NADP as cofactor. Deficiency can result in male pseudohermaphroditism with gynecomastia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510009E07Rik CCGGAAGGGGAGGAGCAGTGACCCAGTTTCGGA CCGGA 16: 21,653,398 probably null Het
Adcy1 T G 11: 7,109,075 L327R probably damaging Het
Amotl1 T C 9: 14,558,565 Q624R probably damaging Het
Ampd1 A G 3: 103,081,058 T106A probably benign Het
Aqr T A 2: 114,136,993 I514F probably damaging Het
Atp2b1 A G 10: 98,969,004 T30A possibly damaging Het
Atp9a A T 2: 168,705,177 Y186N probably benign Het
Bub1 T A 2: 127,829,702 N21I possibly damaging Het
Cachd1 G A 4: 100,953,166 D322N probably damaging Het
Ccdc38 A G 10: 93,575,335 E402G probably damaging Het
Ccl27a A T 4: 41,774,194 probably null Het
Clic5 A T 17: 44,242,105 K82M probably benign Het
Cnot10 A T 9: 114,601,355 S566T probably benign Het
Cul9 T C 17: 46,520,501 T1596A probably damaging Het
Cyp2c55 A G 19: 39,034,372 E318G Het
Epb41l5 A G 1: 119,620,206 F156L probably damaging Het
Ephb4 T A 5: 137,370,805 M819K probably damaging Het
Esr1 A G 10: 4,746,654 R168G possibly damaging Het
Fbxw10 C A 11: 62,875,005 Y700* probably null Het
Fras1 G T 5: 96,781,279 R3847S probably benign Het
Gm11110 T C 17: 57,103,439 T20A unknown Het
Gm996 A T 2: 25,577,902 S666T probably benign Het
Gpr150 G T 13: 76,056,409 S139* probably null Het
Grm1 A T 10: 10,719,537 N782K probably damaging Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Hmcn2 A G 2: 31,433,392 S4173G possibly damaging Het
Hmx1 T A 5: 35,392,167 V268D probably damaging Het
Hsbp1l1 T C 18: 80,235,470 T33A possibly damaging Het
Igll1 A T 16: 16,863,712 W60R probably benign Het
Itga11 A G 9: 62,757,611 T593A probably benign Het
Kat6a A G 8: 22,938,808 D1393G possibly damaging Het
Krt36 A G 11: 100,105,347 F84L probably benign Het
Macrod1 T C 19: 7,197,020 S266P probably damaging Het
Mib2 A G 4: 155,659,716 V163A probably damaging Het
Mpl A G 4: 118,444,066 L534P Het
Mut A G 17: 40,937,393 T104A probably damaging Het
Myo3b C A 2: 70,426,908 H1317N probably benign Het
Nkx2-6 A G 14: 69,171,971 D57G probably benign Het
Olfr1176 T G 2: 88,339,605 F13L possibly damaging Het
Olfr1449 T C 19: 12,934,828 V30A probably benign Het
Olfr374 A G 8: 72,110,432 I289V probably damaging Het
Olfr507 A G 7: 108,622,712 N300S probably damaging Het
Olfr750 A G 14: 51,071,208 Y62H probably damaging Het
Olfr853 A T 9: 19,537,464 D155E possibly damaging Het
Osbpl11 T A 16: 33,227,237 H523Q probably damaging Het
Pde1c A T 6: 56,179,143 S148T possibly damaging Het
Pign G A 1: 105,591,634 A521V possibly damaging Het
Pprc1 A G 19: 46,071,744 M1536V possibly damaging Het
Prg4 C A 1: 150,456,059 A288S possibly damaging Het
Prim2 A T 1: 33,630,432 I154N possibly damaging Het
Prkdc T C 16: 15,727,726 V1902A probably benign Het
Rgs22 A T 15: 36,025,981 C1056S probably damaging Het
Schip1 T C 3: 68,495,103 L199P possibly damaging Het
Sema4d A T 13: 51,700,899 L54* probably null Het
Sgsm1 C T 5: 113,273,629 G531R probably benign Het
Tas1r2 T C 4: 139,667,403 F519S probably damaging Het
Tnfsf11 C T 14: 78,278,679 R283Q possibly damaging Het
Tril C T 6: 53,820,217 V7M possibly damaging Het
Trim41 TTCCTCCTCCTCCTCCTCCTCCTCCTCC TTCCTCCTCCTCCTCCTCCTCCTCC 11: 48,816,257 probably benign Het
Tsr1 T A 11: 74,899,391 Y137* probably null Het
Ubr5 A G 15: 38,041,909 S148P Het
Zfp606 A G 7: 12,489,579 T64A possibly damaging Het
Other mutations in Hsd17b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Hsd17b3 APN 13 64062905 missense probably damaging 1.00
IGL02221:Hsd17b3 APN 13 64089051 missense probably benign 0.01
IGL02257:Hsd17b3 APN 13 64059462 missense probably benign 0.14
IGL02745:Hsd17b3 APN 13 64087176 missense probably benign 0.01
IGL03189:Hsd17b3 APN 13 64063087 critical splice donor site probably null
hermine UTSW 13 64062906 missense probably damaging 1.00
IGL02988:Hsd17b3 UTSW 13 64089100 missense probably damaging 0.96
R0116:Hsd17b3 UTSW 13 64058589 missense possibly damaging 0.87
R0659:Hsd17b3 UTSW 13 64073936 missense possibly damaging 0.87
R0684:Hsd17b3 UTSW 13 64089068 missense probably benign
R0834:Hsd17b3 UTSW 13 64089122 missense probably benign 0.00
R3750:Hsd17b3 UTSW 13 64063179 splice site probably null
R3845:Hsd17b3 UTSW 13 64089062 missense possibly damaging 0.94
R3973:Hsd17b3 UTSW 13 64059486 missense probably damaging 1.00
R4602:Hsd17b3 UTSW 13 64063170 critical splice acceptor site probably null
R5027:Hsd17b3 UTSW 13 64062906 missense probably damaging 1.00
R5470:Hsd17b3 UTSW 13 64073899 missense probably damaging 1.00
R5897:Hsd17b3 UTSW 13 64088985 critical splice donor site probably null
R5992:Hsd17b3 UTSW 13 64059470 splice site probably null
R6898:Hsd17b3 UTSW 13 64059525 missense probably benign 0.06
R7297:Hsd17b3 UTSW 13 64076351 missense probably damaging 1.00
R7555:Hsd17b3 UTSW 13 64072002 missense probably benign 0.17
R8743:Hsd17b3 UTSW 13 64062898 missense probably benign 0.00
R8786:Hsd17b3 UTSW 13 64072048 missense probably damaging 1.00
R8994:Hsd17b3 UTSW 13 64062881 missense probably damaging 1.00
R9324:Hsd17b3 UTSW 13 64058645 missense possibly damaging 0.49
Z1176:Hsd17b3 UTSW 13 64063138 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCTTGGCCCAGAATGATCTC -3'
(R):5'- GCTGGACAATTTGCCATCTG -3'

Sequencing Primer
(F):5'- CTCCAATAATCACAGTGTTTGGTC -3'
(R):5'- GGACAATTTGCCATCTGTCTAG -3'
Posted On 2021-08-02