Mutagenetix > Incidental Mutation

Incidental Mutation 'R8904:Tnfsf11'

678395

Institutional Source

Beutler Lab

Gene Symbol

Tnfsf11

Ensembl Gene

ENSMUSG00000022015

Gene Name

tumor necrosis factor (ligand) superfamily, member 11

Synonyms

Ly109l, Trance, osteoclast differentiation factor, RANKL, OPGL, OPGL, ODF

MMRRC Submission

068761-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.435) question?

Stock #

R8904 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

78514886-78545483 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 78516119 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 283 (R283Q)

Ref Sequence

ENSEMBL: ENSMUSP00000022592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022592]

AlphaFold

O35235

PDB Structure

CRYSTAL STRUCTURE OF THE EXTRACELLULAR DOMAIN OF MOUSE RANK LIGAND [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF TRANCE/RANKL CYTOKINE. [X-RAY DIFFRACTION]
Mouse RANKL Structure at 1.9A Resolution [X-RAY DIFFRACTION]
Crystal structure of mouse RANKL-RANK complex [X-RAY DIFFRACTION]
Crystal structure of extracellular domains of mouse RANK-RANKL complex [X-RAY DIFFRACTION]
Crystal structure of mouse RANKL-OPG complex [X-RAY DIFFRACTION]
Crystal Structure of mouse RANK bound to RANKL [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022592
AA Change: R283Q

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000022592
Gene: ENSMUSG00000022015
AA Change: R283Q

Domain	Start	End	E-Value	Type
low complexity region	32	46	N/A	INTRINSIC
transmembrane domain	49	71	N/A	INTRINSIC
TNF	163	312	7.37e-58	SMART

Meta Mutation Damage Score

0.0896

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

99% (66/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor (TNF) cytokine family which is a ligand for osteoprotegerin and functions as a key factor for osteoclast differentiation and activation. This protein was shown to be a dentritic cell survival factor and is involved in the regulation of T cell-dependent immune response. T cell activation was reported to induce expression of this gene and lead to an increase of osteoclastogenesis and bone loss. This protein was shown to activate antiapoptotic kinase AKT/PKB through a signaling complex involving SRC kinase and tumor necrosis factor receptor-associated factor (TRAF) 6, which indicated this protein may have a role in the regulation of cell apoptosis. Targeted disruption of the related gene in mice led to severe osteopetrosis and a lack of osteoclasts. The deficient mice exhibited defects in early differentiation of T and B lymphocytes, and failed to form lobulo-alveolar mammary structures during pregnancy. Two alternatively spliced transcript variants have been found. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit a failure of tooth eruption, osteopetrosis, failure to lactate and arrested alveolar bud differentiation during pregnancy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510009E07Rik	CCGGAAGGGGAGGAGCAGTGACCCAGTTTCGGA	CCGGA	16: 21,472,148 (GRCm39)		probably null	Het
Adcy1	T	G	11: 7,059,075 (GRCm39)	L327R	probably damaging	Het
Ajm1	A	T	2: 25,467,914 (GRCm39)	S666T	probably benign	Het
Amotl1	T	C	9: 14,469,861 (GRCm39)	Q624R	probably damaging	Het
Ampd1	A	G	3: 102,988,374 (GRCm39)	T106A	probably benign	Het
Aqr	T	A	2: 113,967,474 (GRCm39)	I514F	probably damaging	Het
Atp2b1	A	G	10: 98,804,866 (GRCm39)	T30A	possibly damaging	Het
Atp9a	A	T	2: 168,547,097 (GRCm39)	Y186N	probably benign	Het
Bub1	T	A	2: 127,671,622 (GRCm39)	N21I	possibly damaging	Het
Cachd1	G	A	4: 100,810,363 (GRCm39)	D322N	probably damaging	Het
Ccdc38	A	G	10: 93,411,197 (GRCm39)	E402G	probably damaging	Het
Ccl27a	A	T	4: 41,774,194 (GRCm39)		probably null	Het
Clec4a4	T	C	6: 122,990,836 (GRCm39)		probably benign	Het
Clic5	A	T	17: 44,552,992 (GRCm39)	K82M	probably benign	Het
Cnot10	A	T	9: 114,430,423 (GRCm39)	S566T	probably benign	Het
Cul9	T	C	17: 46,831,427 (GRCm39)	T1596A	probably damaging	Het
Cyp2c55	A	G	19: 39,022,816 (GRCm39)	E318G		Het
Entpd8	A	C	2: 24,973,575 (GRCm39)		probably benign	Het
Epb41l5	A	G	1: 119,547,936 (GRCm39)	F156L	probably damaging	Het
Ephb4	T	A	5: 137,369,067 (GRCm39)	M819K	probably damaging	Het
Esr1	A	G	10: 4,696,654 (GRCm39)	R168G	possibly damaging	Het
Fbxw10	C	A	11: 62,765,831 (GRCm39)	Y700*	probably null	Het
Fras1	G	T	5: 96,929,138 (GRCm39)	R3847S	probably benign	Het
Gm11110	T	C	17: 57,410,439 (GRCm39)	T20A	unknown	Het
Gpr150	G	T	13: 76,204,528 (GRCm39)	S139*	probably null	Het
Grm1	A	T	10: 10,595,281 (GRCm39)	N782K	probably damaging	Het
Hmcn2	A	G	2: 31,323,404 (GRCm39)	S4173G	possibly damaging	Het
Hmx1	T	A	5: 35,549,511 (GRCm39)	V268D	probably damaging	Het
Hsbp1l1	T	C	18: 80,278,685 (GRCm39)	T33A	possibly damaging	Het
Hsd17b3	T	C	13: 64,212,194 (GRCm39)	T161A	probably damaging	Het
Igll1	A	T	16: 16,681,576 (GRCm39)	W60R	probably benign	Het
Itga11	A	G	9: 62,664,893 (GRCm39)	T593A	probably benign	Het
Kat6a	A	G	8: 23,428,824 (GRCm39)	D1393G	possibly damaging	Het
Krt36	A	G	11: 99,996,173 (GRCm39)	F84L	probably benign	Het
Macrod1	T	C	19: 7,174,385 (GRCm39)	S266P	probably damaging	Het
Mib2	A	G	4: 155,744,173 (GRCm39)	V163A	probably damaging	Het
Mmut	A	G	17: 41,248,284 (GRCm39)	T104A	probably damaging	Het
Mpl	A	G	4: 118,301,263 (GRCm39)	L534P		Het
Myo3b	C	A	2: 70,257,252 (GRCm39)	H1317N	probably benign	Het
Nkx2-6	A	G	14: 69,409,420 (GRCm39)	D57G	probably benign	Het
Or1ab2	A	G	8: 72,864,276 (GRCm39)	I289V	probably damaging	Het
Or5b24	T	C	19: 12,912,192 (GRCm39)	V30A	probably benign	Het
Or5d46	T	G	2: 88,169,949 (GRCm39)	F13L	possibly damaging	Het
Or5p79	A	G	7: 108,221,919 (GRCm39)	N300S	probably damaging	Het
Or6s1	A	G	14: 51,308,665 (GRCm39)	Y62H	probably damaging	Het
Or7g33	A	T	9: 19,448,760 (GRCm39)	D155E	possibly damaging	Het
Osbpl11	T	A	16: 33,047,607 (GRCm39)	H523Q	probably damaging	Het
Pde1c	A	T	6: 56,156,128 (GRCm39)	S148T	possibly damaging	Het
Pign	G	A	1: 105,519,359 (GRCm39)	A521V	possibly damaging	Het
Pprc1	A	G	19: 46,060,183 (GRCm39)	M1536V	possibly damaging	Het
Prg4	C	A	1: 150,331,810 (GRCm39)	A288S	possibly damaging	Het
Prim2	A	T	1: 33,669,513 (GRCm39)	I154N	possibly damaging	Het
Prkdc	T	C	16: 15,545,590 (GRCm39)	V1902A	probably benign	Het
Prss40	C	T	1: 34,595,045 (GRCm39)		probably benign	Het
Ret	C	T	6: 118,157,174 (GRCm39)		probably benign	Het
Rgs22	A	T	15: 36,026,127 (GRCm39)	C1056S	probably damaging	Het
Schip1	T	C	3: 68,402,436 (GRCm39)	L199P	possibly damaging	Het
Sema4d	A	T	13: 51,854,935 (GRCm39)	L54*	probably null	Het
Sgsm1	C	T	5: 113,421,495 (GRCm39)	G531R	probably benign	Het
Tas1r2	T	C	4: 139,394,714 (GRCm39)	F519S	probably damaging	Het
Tril	C	T	6: 53,797,202 (GRCm39)	V7M	possibly damaging	Het
Tsr1	T	A	11: 74,790,217 (GRCm39)	Y137*	probably null	Het
Ubr5	A	G	15: 38,042,153 (GRCm39)	S148P		Het
Unc13b	A	G	4: 43,178,531 (GRCm39)		probably benign	Het
Zfp606	A	G	7: 12,223,506 (GRCm39)	T64A	possibly damaging	Het

Other mutations in Tnfsf11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02601:Tnfsf11	APN	14	78,537,385 (GRCm39)	nonsense	probably null
R0352:Tnfsf11	UTSW	14	78,516,408 (GRCm39)	missense	probably benign	0.17
R0377:Tnfsf11	UTSW	14	78,537,352 (GRCm39)	missense	probably benign	0.00
R2062:Tnfsf11	UTSW	14	78,516,362 (GRCm39)	missense	probably damaging	1.00
R2121:Tnfsf11	UTSW	14	78,537,333 (GRCm39)	missense	probably benign	0.32
R2178:Tnfsf11	UTSW	14	78,521,682 (GRCm39)	missense	probably benign	0.00
R2237:Tnfsf11	UTSW	14	78,537,421 (GRCm39)	missense	possibly damaging	0.77
R2238:Tnfsf11	UTSW	14	78,537,421 (GRCm39)	missense	possibly damaging	0.77
R2239:Tnfsf11	UTSW	14	78,537,421 (GRCm39)	missense	possibly damaging	0.77
R2430:Tnfsf11	UTSW	14	78,521,752 (GRCm39)	missense	probably benign	0.00
R4155:Tnfsf11	UTSW	14	78,537,309 (GRCm39)	missense	probably benign	0.28
R4197:Tnfsf11	UTSW	14	78,521,752 (GRCm39)	missense	probably benign	0.00
R4562:Tnfsf11	UTSW	14	78,516,020 (GRCm39)	missense	probably damaging	1.00
R6141:Tnfsf11	UTSW	14	78,545,299 (GRCm39)	missense	probably damaging	0.99
R8063:Tnfsf11	UTSW	14	78,516,098 (GRCm39)	missense	probably damaging	1.00
X0020:Tnfsf11	UTSW	14	78,516,317 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGTTTCATACACCGTGGGC -3'
(R):5'- ATGAAACATCGGGAAGCGTACC -3'

Sequencing Primer
(F):5'- ACCGTGGGCCATGTCTCTTAG -3'
(R):5'- ACCTACAGACTATCTTCAGCTGATGG -3'

Posted On

2021-08-02