Incidental Mutation 'R8907:Serpinb13'
ID 678419
Institutional Source Beutler Lab
Gene Symbol Serpinb13
Ensembl Gene ENSMUSG00000048775
Gene Name serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 13
Synonyms HURPIN, headpin, HUR7, PI13
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R8907 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 106980984-107001195 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 107000789 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 380 (I380F)
Ref Sequence ENSEMBL: ENSMUSP00000027564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027564] [ENSMUST00000136766]
AlphaFold Q8CDC0
Predicted Effect probably damaging
Transcript: ENSMUST00000027564
AA Change: I380F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027564
Gene: ENSMUSG00000048775
AA Change: I380F

DomainStartEndE-ValueType
SERPIN 13 389 1.55e-144 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136766
SMART Domains Protein: ENSMUSP00000118572
Gene: ENSMUSG00000048775

DomainStartEndE-ValueType
Pfam:Serpin 6 94 1.1e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of serine protease inhibitors. The encoded protein inhibits the activity of cathepsin K and is itself transcriptionally repressed by RUNX1. This gene is downregulated in many types of cancer. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 36,948,146 Y1413* probably null Het
5930422O12Rik A G 8: 33,429,370 I73V probably damaging Het
Agap3 T C 5: 24,474,631 I109T probably benign Het
Ahnak G A 19: 9,009,088 V2579M probably benign Het
Akap13 T C 7: 75,610,696 S220P probably benign Het
Akap13 C G 7: 75,610,708 P224A probably damaging Het
Alpk1 G A 3: 127,680,993 Q454* probably null Het
Asrgl1 C T 19: 9,113,142 G280D probably damaging Het
Atp6v0d1 TTCTTACCTC T 8: 105,525,150 probably benign Het
Atxn2l T A 7: 126,500,253 D204V probably damaging Het
B430306N03Rik T C 17: 48,321,072 Y177H probably damaging Het
Bcl2l14 G A 6: 134,423,622 C2Y probably damaging Het
Bphl A T 13: 34,046,947 M125L possibly damaging Het
Cdh10 A T 15: 19,013,435 N707I probably damaging Het
Ceacam1 T A 7: 25,472,019 D340V possibly damaging Het
Cklf G A 8: 104,251,039 V8I probably benign Het
Cln5 A G 14: 103,073,275 N126S probably damaging Het
Col5a2 A T 1: 45,416,946 M327K probably benign Het
Col6a6 A T 9: 105,767,329 F1253L probably damaging Het
Crb2 G A 2: 37,795,383 S1169N probably benign Het
Cspg4 A T 9: 56,883,683 D72V probably damaging Het
Ctnnd2 C T 15: 30,905,727 P840L probably damaging Het
Eea1 T C 10: 95,990,412 Y105H probably damaging Het
Epha4 A C 1: 77,506,785 S196A probably damaging Het
Evx1 C T 6: 52,316,761 R305C probably damaging Het
Fcamr G T 1: 130,812,591 G249V probably damaging Het
Fdxacb1 C T 9: 50,770,151 T124I probably damaging Het
Fmn1 T G 2: 113,525,569 L883R unknown Het
Frmd4b T C 6: 97,296,085 N782S probably damaging Het
Frmpd2 T G 14: 33,526,423 C621W probably damaging Het
Fsip2 T A 2: 82,986,640 V4239D probably benign Het
Gcnt4 A G 13: 96,947,336 Y380C probably damaging Het
Gm7298 T C 6: 121,764,858 V413A probably benign Het
Gstp3 C T 19: 4,058,145 V93M possibly damaging Het
Helz2 A T 2: 181,233,127 M1858K possibly damaging Het
Ighv1-7 T A 12: 114,538,733 K38M probably damaging Het
Klri1 T C 6: 129,703,320 K124R probably null Het
Kmt2c A T 5: 25,309,611 F3078Y probably damaging Het
Map4k4 C T 1: 40,019,610 P988L probably damaging Het
Mmrn1 G A 6: 60,976,093 E453K probably damaging Het
Muc5b T A 7: 141,864,138 V3607E probably benign Het
Myo15 T A 11: 60,526,608 I3461N Het
Ngef G A 1: 87,477,654 S678F probably damaging Het
Npc1l1 A T 11: 6,228,157 S418T probably benign Het
Nprl2 A G 9: 107,544,796 D257G probably damaging Het
Olfr1218 A T 2: 89,055,198 V76D probably damaging Het
Pard3b A G 1: 62,344,135 D796G probably benign Het
Pcf11 T C 7: 92,653,243 T1220A probably benign Het
Pkhd1 T C 1: 20,117,561 I3508V possibly damaging Het
Ppargc1a A T 5: 51,490,228 S258T probably damaging Het
Prom1 A G 5: 44,001,793 Y830H probably damaging Het
Ptprm T A 17: 66,744,737 H1001L probably damaging Het
Rab8b A G 9: 66,919,525 F37L probably benign Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,918 probably benign Het
Sdk1 A T 5: 142,084,523 I1148F probably damaging Het
Sec62 A G 3: 30,810,472 K162E unknown Het
Sptb T C 12: 76,587,412 D2175G probably benign Het
St3gal6 T C 16: 58,493,732 I13V probably benign Het
Tfpi2 A T 6: 3,967,996 L48H probably damaging Het
Tmem121b T A 6: 120,492,746 I337F probably damaging Het
Tpbgl T C 7: 99,625,975 D225G probably benign Het
Trpa1 A G 1: 14,889,440 V674A probably benign Het
Trpa1 A G 1: 14,893,339 L553P probably damaging Het
Tyrp1 T C 4: 80,837,561 V189A probably damaging Het
Vmn1r19 G T 6: 57,405,006 M181I probably benign Het
Vmn2r10 T C 5: 109,001,925 T418A probably benign Het
Zfp617 A G 8: 71,933,083 Y419C probably damaging Het
Other mutations in Serpinb13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00558:Serpinb13 APN 1 106996380 missense probably damaging 1.00
IGL01758:Serpinb13 APN 1 107000754 missense probably damaging 1.00
IGL02078:Serpinb13 APN 1 106998958 missense probably damaging 0.99
IGL02183:Serpinb13 APN 1 106998910 missense probably damaging 1.00
PIT4651001:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R0683:Serpinb13 UTSW 1 106999021 missense probably damaging 1.00
R1263:Serpinb13 UTSW 1 107000736 missense probably damaging 0.97
R1535:Serpinb13 UTSW 1 106982156 start codon destroyed probably null 1.00
R1929:Serpinb13 UTSW 1 106999026 missense possibly damaging 0.85
R2271:Serpinb13 UTSW 1 106999026 missense possibly damaging 0.85
R2655:Serpinb13 UTSW 1 107000427 missense probably damaging 0.99
R3115:Serpinb13 UTSW 1 106982838 missense probably null 0.15
R3418:Serpinb13 UTSW 1 106998927 missense probably damaging 0.99
R3419:Serpinb13 UTSW 1 106998927 missense probably damaging 0.99
R3883:Serpinb13 UTSW 1 106998572 missense probably benign 0.37
R4664:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4666:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4689:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4690:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4725:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4728:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R4847:Serpinb13 UTSW 1 106982844 missense probably damaging 1.00
R5249:Serpinb13 UTSW 1 106998697 missense probably damaging 1.00
R5501:Serpinb13 UTSW 1 106982185 missense possibly damaging 0.81
R5507:Serpinb13 UTSW 1 106998602 missense probably benign 0.00
R6015:Serpinb13 UTSW 1 107000607 missense probably benign 0.00
R6363:Serpinb13 UTSW 1 107000774 nonsense probably null
R6720:Serpinb13 UTSW 1 106994062 missense probably benign 0.12
R6847:Serpinb13 UTSW 1 106998933 missense probably benign 0.24
R7237:Serpinb13 UTSW 1 106998949 missense probably damaging 1.00
R8966:Serpinb13 UTSW 1 107000435 missense probably damaging 1.00
R9011:Serpinb13 UTSW 1 106995789 missense probably benign 0.01
R9350:Serpinb13 UTSW 1 106995832 nonsense probably null
R9375:Serpinb13 UTSW 1 106982267 missense probably damaging 1.00
Z1177:Serpinb13 UTSW 1 106982303 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CATGCGGACTACTCAGGAATG -3'
(R):5'- TCCTGAGTAGTGCACACATGATTG -3'

Sequencing Primer
(F):5'- ACTACTCAGGAATGTCGGCG -3'
(R):5'- GTAGTGCACACATGATTGAGATTAAC -3'
Posted On 2021-08-02