Incidental Mutation 'R8909:Myo3b'
ID 678487
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Name myosin IIIB
Synonyms A430065P19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8909 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 70039126-70429198 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 70253096 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 698 (A698T)
Ref Sequence ENSEMBL: ENSMUSP00000055362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112243]
AlphaFold Q1EG27
Predicted Effect probably damaging
Transcript: ENSMUST00000060208
AA Change: A698T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: A698T

S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112243
AA Change: A670T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: A670T

S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Meta Mutation Damage Score 0.8450 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G T 13: 63,240,297 R698L possibly damaging Het
Btnl10 T C 11: 58,922,372 C276R probably benign Het
Cavin4 G A 4: 48,672,421 G289R probably benign Het
Cdh9 T C 15: 16,848,524 F430S probably damaging Het
Cfh A G 1: 140,086,348 I1246T possibly damaging Het
Chd8 C T 14: 52,212,932 V1490M possibly damaging Het
Clec2g A G 6: 128,981,232 N137S probably benign Het
Cntn6 T A 6: 104,848,132 S878T probably benign Het
Cryga G T 1: 65,103,014 S73R probably benign Het
Dach1 T C 14: 98,168,684 D209G probably damaging Het
Duox2 A G 2: 122,296,381 S218P probably benign Het
Fbn2 T A 18: 58,059,436 Q1491L possibly damaging Het
Foxg1 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 12: 49,384,692 probably benign Het
Glra3 A T 8: 55,991,124 probably null Het
Helz A G 11: 107,666,008 D1284G possibly damaging Het
Iqsec3 G A 6: 121,413,159 A451V unknown Het
Kat6b A G 14: 21,669,146 T1189A probably benign Het
Lama1 T A 17: 67,772,741 F1203Y Het
Lingo2 A G 4: 35,708,349 S544P probably damaging Het
Llcfc1 T C 6: 41,684,591 V25A probably benign Het
Map1a A C 2: 121,298,910 H143P probably damaging Het
Mbd5 T C 2: 49,279,221 V1468A probably benign Het
Meis3 T A 7: 16,185,460 M367K possibly damaging Het
Mfsd7a C T 5: 108,444,566 V253I probably benign Het
Nbn A T 4: 15,970,833 D272V probably damaging Het
Olfr1065 C T 2: 86,445,738 M81I possibly damaging Het
Olfr644 A G 7: 104,068,825 S69P probably damaging Het
Olfr683 C T 7: 105,144,042 V84I probably benign Het
Olfr835 G T 9: 19,035,592 M156I probably benign Het
Os9 C A 10: 127,120,956 probably null Het
Pard3b A G 1: 62,344,135 D796G probably benign Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Pkp4 A G 2: 59,354,414 E1180G possibly damaging Het
Plod1 T A 4: 147,927,106 K221* probably null Het
Ppp6r3 T C 19: 3,459,461 T795A probably benign Het
Pramef20 T C 4: 144,376,983 Q191R probably benign Het
Prokr2 T C 2: 132,373,803 E246G probably damaging Het
Psmb7 A G 2: 38,613,469 M178T probably damaging Het
Rbm39 C T 2: 156,177,777 probably benign Het
Saa1 T C 7: 46,741,349 N46S probably benign Het
Samd12 A G 15: 53,658,457 L119P probably damaging Het
Sdc3 A G 4: 130,818,783 E151G unknown Het
Serpina1a T C 12: 103,854,679 K370E probably damaging Het
Tnrc18 C A 5: 142,776,376 S681I Het
Ulk2 C T 11: 61,799,554 G636R probably benign Het
V1ra8 T C 6: 90,202,956 L47P possibly damaging Het
Wasf3 T C 5: 146,455,600 L160P Het
Wdr78 T G 4: 103,087,410 E248A possibly damaging Het
Zbtb34 A C 2: 33,411,689 V280G possibly damaging Het
Zfp646 T C 7: 127,879,343 Y231H probably damaging Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 70105645 splice site probably benign
IGL00959:Myo3b APN 2 70314292 missense probably damaging 1.00
IGL01069:Myo3b APN 2 70245391 missense probably benign 0.22
IGL01116:Myo3b APN 2 70289386 missense probably damaging 1.00
IGL02097:Myo3b APN 2 70238829 missense probably damaging 1.00
IGL02220:Myo3b APN 2 70289579 splice site probably benign
IGL02553:Myo3b APN 2 70095224 missense probably benign 0.00
IGL02557:Myo3b APN 2 70255319 missense probably benign 0.16
IGL02648:Myo3b APN 2 70105372 splice site probably benign
IGL02902:Myo3b APN 2 70289401 missense probably benign 0.36
IGL02981:Myo3b APN 2 70108625 missense probably damaging 1.00
IGL03030:Myo3b APN 2 70426816 splice site probably benign
IGL03031:Myo3b APN 2 70255377 missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70426816 splice site probably benign
IGL03078:Myo3b APN 2 70286991 missense probably damaging 1.00
IGL03224:Myo3b APN 2 70349939 missense probably benign
IGL03329:Myo3b APN 2 70254459 missense probably damaging 1.00
R0079:Myo3b UTSW 2 70095158 missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70217166 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0313:Myo3b UTSW 2 70348959 nonsense probably null
R0331:Myo3b UTSW 2 70095261 missense probably damaging 1.00
R0371:Myo3b UTSW 2 70252960 splice site probably benign
R0442:Myo3b UTSW 2 70238961 critical splice donor site probably null
R0964:Myo3b UTSW 2 70426849 missense probably damaging 1.00
R1217:Myo3b UTSW 2 70330880 missense probably benign 0.02
R1429:Myo3b UTSW 2 70253007 missense probably damaging 0.97
R1460:Myo3b UTSW 2 70232454 missense probably benign 0.31
R1617:Myo3b UTSW 2 70281218 missense probably benign 0.00
R1628:Myo3b UTSW 2 70286962 missense probably benign 0.01
R1708:Myo3b UTSW 2 70245385 nonsense probably null
R1940:Myo3b UTSW 2 70258075 missense probably benign 0.01
R2407:Myo3b UTSW 2 70255253 missense probably damaging 1.00
R3081:Myo3b UTSW 2 70256583 splice site probably benign
R3687:Myo3b UTSW 2 70245314 missense probably benign
R3745:Myo3b UTSW 2 70234485 splice site probably benign
R4011:Myo3b UTSW 2 70096376 missense probably benign 0.15
R4074:Myo3b UTSW 2 70289464 missense probably damaging 1.00
R4419:Myo3b UTSW 2 70096362 missense probably damaging 1.00
R4496:Myo3b UTSW 2 70254404 missense probably benign
R4539:Myo3b UTSW 2 70039147 start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70238842 missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R4807:Myo3b UTSW 2 70105712 missense probably damaging 1.00
R4849:Myo3b UTSW 2 70244909 missense probably damaging 0.98
R4997:Myo3b UTSW 2 70258083 missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70258068 missense probably damaging 0.99
R5070:Myo3b UTSW 2 70253112 missense probably damaging 1.00
R5072:Myo3b UTSW 2 70095249 missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70258030 missense probably benign 0.01
R5103:Myo3b UTSW 2 70096403 missense probably benign 0.08
R5109:Myo3b UTSW 2 70095293 missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70426888 missense probably damaging 0.97
R5396:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R5400:Myo3b UTSW 2 70105380 missense probably damaging 1.00
R5468:Myo3b UTSW 2 70234441 missense probably benign 0.00
R5620:Myo3b UTSW 2 70238910 missense probably benign 0.04
R5646:Myo3b UTSW 2 70314430 missense probably damaging 0.97
R5729:Myo3b UTSW 2 70105739 missense probably damaging 1.00
R5943:Myo3b UTSW 2 70286941 missense probably benign 0.03
R5971:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70238769 missense probably benign 0.00
R6138:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70245410 critical splice donor site probably null
R6177:Myo3b UTSW 2 70313363 missense probably benign 0.00
R6421:Myo3b UTSW 2 70313356 missense probably benign 0.02
R6478:Myo3b UTSW 2 70348960 missense probably benign
R6606:Myo3b UTSW 2 70232485 missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70289512 missense probably damaging 1.00
R6982:Myo3b UTSW 2 70426065 missense probably benign 0.02
R6997:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R7032:Myo3b UTSW 2 70095264 missense probably damaging 0.98
R7038:Myo3b UTSW 2 70095208 missense probably benign 0.00
R7062:Myo3b UTSW 2 70217157 missense probably benign 0.00
R7537:Myo3b UTSW 2 70217169 missense probably benign 0.01
R7861:Myo3b UTSW 2 70108688 missense probably damaging 1.00
R7955:Myo3b UTSW 2 70095279 missense probably benign 0.37
R7977:Myo3b UTSW 2 70330933 missense probably benign
R7978:Myo3b UTSW 2 70253114 missense probably damaging 1.00
R7987:Myo3b UTSW 2 70330933 missense probably benign
R8803:Myo3b UTSW 2 70252994 missense probably benign
R8843:Myo3b UTSW 2 70257981 missense probably damaging 1.00
R8896:Myo3b UTSW 2 70238816 missense probably damaging 1.00
R8904:Myo3b UTSW 2 70426908 missense probably benign 0.07
R9031:Myo3b UTSW 2 70251750 missense probably damaging 0.99
R9052:Myo3b UTSW 2 70232403 missense probably benign 0.00
R9251:Myo3b UTSW 2 70258081 nonsense probably null
R9268:Myo3b UTSW 2 70426961 makesense probably null
R9334:Myo3b UTSW 2 70217016 missense probably damaging 1.00
R9377:Myo3b UTSW 2 70238898 missense possibly damaging 0.78
R9457:Myo3b UTSW 2 70095209 missense probably benign 0.01
R9520:Myo3b UTSW 2 70232409 missense possibly damaging 0.67
R9593:Myo3b UTSW 2 70245304 missense probably benign 0.43
R9671:Myo3b UTSW 2 70256564 missense probably damaging 1.00
R9790:Myo3b UTSW 2 70349943 missense probably benign 0.35
R9791:Myo3b UTSW 2 70349943 missense probably benign 0.35
U15987:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70232403 missense probably benign 0.00
X0065:Myo3b UTSW 2 70257969 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70096361 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70258027 missense probably benign 0.01
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2021-08-02