Incidental Mutation 'R8909:Myo3b'
ID 678487
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Name myosin IIIB
Synonyms A430065P19Rik
MMRRC Submission 068700-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8909 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 69869470-70259542 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 70083440 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 698 (A698T)
Ref Sequence ENSEMBL: ENSMUSP00000055362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112243]
AlphaFold Q1EG27
Predicted Effect probably damaging
Transcript: ENSMUST00000060208
AA Change: A698T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: A698T

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112243
AA Change: A670T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: A670T

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Meta Mutation Damage Score 0.8450 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aopep G T 13: 63,388,111 (GRCm39) R698L possibly damaging Het
Btnl10 T C 11: 58,813,198 (GRCm39) C276R probably benign Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 95,990,808 (GRCm39) probably benign Het
Cavin4 G A 4: 48,672,421 (GRCm39) G289R probably benign Het
Cdh9 T C 15: 16,848,610 (GRCm39) F430S probably damaging Het
Cfh A G 1: 140,014,086 (GRCm39) I1246T possibly damaging Het
Chd8 C T 14: 52,450,389 (GRCm39) V1490M possibly damaging Het
Clec2g A G 6: 128,958,195 (GRCm39) N137S probably benign Het
Cntn6 T A 6: 104,825,093 (GRCm39) S878T probably benign Het
Cryga G T 1: 65,142,173 (GRCm39) S73R probably benign Het
Dach1 T C 14: 98,406,120 (GRCm39) D209G probably damaging Het
Dnai4 T G 4: 102,944,607 (GRCm39) E248A possibly damaging Het
Duox2 A G 2: 122,126,862 (GRCm39) S218P probably benign Het
Fbn2 T A 18: 58,192,508 (GRCm39) Q1491L possibly damaging Het
Foxg1 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 12: 49,431,475 (GRCm39) probably benign Het
Glra3 A T 8: 56,444,159 (GRCm39) probably null Het
Helz A G 11: 107,556,834 (GRCm39) D1284G possibly damaging Het
Iqsec3 G A 6: 121,390,118 (GRCm39) A451V unknown Het
Kat6b A G 14: 21,719,214 (GRCm39) T1189A probably benign Het
Lama1 T A 17: 68,079,736 (GRCm39) F1203Y Het
Lingo2 A G 4: 35,708,349 (GRCm39) S544P probably damaging Het
Llcfc1 T C 6: 41,661,525 (GRCm39) V25A probably benign Het
Map1a A C 2: 121,129,391 (GRCm39) H143P probably damaging Het
Mbd5 T C 2: 49,169,233 (GRCm39) V1468A probably benign Het
Meis3 T A 7: 15,919,385 (GRCm39) M367K possibly damaging Het
Nbn A T 4: 15,970,833 (GRCm39) D272V probably damaging Het
Or51a43 A G 7: 103,718,032 (GRCm39) S69P probably damaging Het
Or56a5 C T 7: 104,793,249 (GRCm39) V84I probably benign Het
Or7g20 G T 9: 18,946,888 (GRCm39) M156I probably benign Het
Or8k27 C T 2: 86,276,082 (GRCm39) M81I possibly damaging Het
Os9 C A 10: 126,956,825 (GRCm39) probably null Het
Pard3b A G 1: 62,383,294 (GRCm39) D796G probably benign Het
Peg10 T TCCG 6: 4,756,451 (GRCm39) probably benign Het
Pkp4 A G 2: 59,184,758 (GRCm39) E1180G possibly damaging Het
Plod1 T A 4: 148,011,563 (GRCm39) K221* probably null Het
Ppp6r3 T C 19: 3,509,461 (GRCm39) T795A probably benign Het
Pramel15 T C 4: 144,103,553 (GRCm39) Q191R probably benign Het
Prokr2 T C 2: 132,215,723 (GRCm39) E246G probably damaging Het
Psmb7 A G 2: 38,503,481 (GRCm39) M178T probably damaging Het
Rbm39 C T 2: 156,019,697 (GRCm39) probably benign Het
Saa1 T C 7: 46,390,773 (GRCm39) N46S probably benign Het
Samd12 A G 15: 53,521,853 (GRCm39) L119P probably damaging Het
Sdc3 A G 4: 130,546,094 (GRCm39) E151G unknown Het
Serpina1a T C 12: 103,820,938 (GRCm39) K370E probably damaging Het
Slc49a3 C T 5: 108,592,432 (GRCm39) V253I probably benign Het
Tnrc18 C A 5: 142,762,131 (GRCm39) S681I Het
Ulk2 C T 11: 61,690,380 (GRCm39) G636R probably benign Het
V1ra8 T C 6: 90,179,938 (GRCm39) L47P possibly damaging Het
Wasf3 T C 5: 146,392,410 (GRCm39) L160P Het
Zbtb34 A C 2: 33,301,701 (GRCm39) V280G possibly damaging Het
Zfp646 T C 7: 127,478,515 (GRCm39) Y231H probably damaging Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 69,935,989 (GRCm39) splice site probably benign
IGL00959:Myo3b APN 2 70,144,636 (GRCm39) missense probably damaging 1.00
IGL01069:Myo3b APN 2 70,075,735 (GRCm39) missense probably benign 0.22
IGL01116:Myo3b APN 2 70,119,730 (GRCm39) missense probably damaging 1.00
IGL02097:Myo3b APN 2 70,069,173 (GRCm39) missense probably damaging 1.00
IGL02220:Myo3b APN 2 70,119,923 (GRCm39) splice site probably benign
IGL02553:Myo3b APN 2 69,925,568 (GRCm39) missense probably benign 0.00
IGL02557:Myo3b APN 2 70,085,663 (GRCm39) missense probably benign 0.16
IGL02648:Myo3b APN 2 69,935,716 (GRCm39) splice site probably benign
IGL02902:Myo3b APN 2 70,119,745 (GRCm39) missense probably benign 0.36
IGL02981:Myo3b APN 2 69,938,969 (GRCm39) missense probably damaging 1.00
IGL03030:Myo3b APN 2 70,257,160 (GRCm39) splice site probably benign
IGL03031:Myo3b APN 2 70,085,721 (GRCm39) missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70,257,160 (GRCm39) splice site probably benign
IGL03078:Myo3b APN 2 70,117,335 (GRCm39) missense probably damaging 1.00
IGL03224:Myo3b APN 2 70,180,283 (GRCm39) missense probably benign
IGL03329:Myo3b APN 2 70,084,803 (GRCm39) missense probably damaging 1.00
R0079:Myo3b UTSW 2 69,925,502 (GRCm39) missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70,047,510 (GRCm39) missense probably benign 0.00
R0238:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0238:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0239:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0239:Myo3b UTSW 2 69,935,769 (GRCm39) missense probably benign 0.00
R0313:Myo3b UTSW 2 70,179,303 (GRCm39) nonsense probably null
R0331:Myo3b UTSW 2 69,925,605 (GRCm39) missense probably damaging 1.00
R0371:Myo3b UTSW 2 70,083,304 (GRCm39) splice site probably benign
R0442:Myo3b UTSW 2 70,069,305 (GRCm39) critical splice donor site probably null
R0964:Myo3b UTSW 2 70,257,193 (GRCm39) missense probably damaging 1.00
R1217:Myo3b UTSW 2 70,161,224 (GRCm39) missense probably benign 0.02
R1429:Myo3b UTSW 2 70,083,351 (GRCm39) missense probably damaging 0.97
R1460:Myo3b UTSW 2 70,062,798 (GRCm39) missense probably benign 0.31
R1617:Myo3b UTSW 2 70,111,562 (GRCm39) missense probably benign 0.00
R1628:Myo3b UTSW 2 70,117,306 (GRCm39) missense probably benign 0.01
R1708:Myo3b UTSW 2 70,075,729 (GRCm39) nonsense probably null
R1940:Myo3b UTSW 2 70,088,419 (GRCm39) missense probably benign 0.01
R2407:Myo3b UTSW 2 70,085,597 (GRCm39) missense probably damaging 1.00
R3081:Myo3b UTSW 2 70,086,927 (GRCm39) splice site probably benign
R3687:Myo3b UTSW 2 70,075,658 (GRCm39) missense probably benign
R3745:Myo3b UTSW 2 70,064,829 (GRCm39) splice site probably benign
R4011:Myo3b UTSW 2 69,926,720 (GRCm39) missense probably benign 0.15
R4074:Myo3b UTSW 2 70,119,808 (GRCm39) missense probably damaging 1.00
R4419:Myo3b UTSW 2 69,926,706 (GRCm39) missense probably damaging 1.00
R4496:Myo3b UTSW 2 70,084,748 (GRCm39) missense probably benign
R4539:Myo3b UTSW 2 69,869,491 (GRCm39) start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70,069,186 (GRCm39) missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R4807:Myo3b UTSW 2 69,936,056 (GRCm39) missense probably damaging 1.00
R4849:Myo3b UTSW 2 70,075,253 (GRCm39) missense probably damaging 0.98
R4997:Myo3b UTSW 2 70,088,427 (GRCm39) missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70,088,412 (GRCm39) missense probably damaging 0.99
R5070:Myo3b UTSW 2 70,083,456 (GRCm39) missense probably damaging 1.00
R5072:Myo3b UTSW 2 69,925,593 (GRCm39) missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70,088,374 (GRCm39) missense probably benign 0.01
R5103:Myo3b UTSW 2 69,926,747 (GRCm39) missense probably benign 0.08
R5109:Myo3b UTSW 2 69,925,637 (GRCm39) missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70,257,232 (GRCm39) missense probably damaging 0.97
R5396:Myo3b UTSW 2 69,957,329 (GRCm39) missense probably damaging 0.99
R5400:Myo3b UTSW 2 69,935,724 (GRCm39) missense probably damaging 1.00
R5468:Myo3b UTSW 2 70,064,785 (GRCm39) missense probably benign 0.00
R5620:Myo3b UTSW 2 70,069,254 (GRCm39) missense probably benign 0.04
R5646:Myo3b UTSW 2 70,144,774 (GRCm39) missense probably damaging 0.97
R5729:Myo3b UTSW 2 69,936,083 (GRCm39) missense probably damaging 1.00
R5943:Myo3b UTSW 2 70,117,285 (GRCm39) missense probably benign 0.03
R5971:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70,069,113 (GRCm39) missense probably benign 0.00
R6138:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70,075,754 (GRCm39) critical splice donor site probably null
R6177:Myo3b UTSW 2 70,143,707 (GRCm39) missense probably benign 0.00
R6421:Myo3b UTSW 2 70,143,700 (GRCm39) missense probably benign 0.02
R6478:Myo3b UTSW 2 70,179,304 (GRCm39) missense probably benign
R6606:Myo3b UTSW 2 70,062,829 (GRCm39) missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70,119,856 (GRCm39) missense probably damaging 1.00
R6982:Myo3b UTSW 2 70,256,409 (GRCm39) missense probably benign 0.02
R6997:Myo3b UTSW 2 69,957,329 (GRCm39) missense probably damaging 0.99
R7032:Myo3b UTSW 2 69,925,608 (GRCm39) missense probably damaging 0.98
R7038:Myo3b UTSW 2 69,925,552 (GRCm39) missense probably benign 0.00
R7062:Myo3b UTSW 2 70,047,501 (GRCm39) missense probably benign 0.00
R7537:Myo3b UTSW 2 70,047,513 (GRCm39) missense probably benign 0.01
R7861:Myo3b UTSW 2 69,939,032 (GRCm39) missense probably damaging 1.00
R7955:Myo3b UTSW 2 69,925,623 (GRCm39) missense probably benign 0.37
R7977:Myo3b UTSW 2 70,161,277 (GRCm39) missense probably benign
R7978:Myo3b UTSW 2 70,083,458 (GRCm39) missense probably damaging 1.00
R7987:Myo3b UTSW 2 70,161,277 (GRCm39) missense probably benign
R8803:Myo3b UTSW 2 70,083,338 (GRCm39) missense probably benign
R8843:Myo3b UTSW 2 70,088,325 (GRCm39) missense probably damaging 1.00
R8896:Myo3b UTSW 2 70,069,160 (GRCm39) missense probably damaging 1.00
R8904:Myo3b UTSW 2 70,257,252 (GRCm39) missense probably benign 0.07
R9031:Myo3b UTSW 2 70,082,094 (GRCm39) missense probably damaging 0.99
R9052:Myo3b UTSW 2 70,062,747 (GRCm39) missense probably benign 0.00
R9251:Myo3b UTSW 2 70,088,425 (GRCm39) nonsense probably null
R9268:Myo3b UTSW 2 70,257,305 (GRCm39) makesense probably null
R9334:Myo3b UTSW 2 70,047,360 (GRCm39) missense probably damaging 1.00
R9377:Myo3b UTSW 2 70,069,242 (GRCm39) missense possibly damaging 0.78
R9457:Myo3b UTSW 2 69,925,553 (GRCm39) missense probably benign 0.01
R9520:Myo3b UTSW 2 70,062,753 (GRCm39) missense possibly damaging 0.67
R9593:Myo3b UTSW 2 70,075,648 (GRCm39) missense probably benign 0.43
R9671:Myo3b UTSW 2 70,086,908 (GRCm39) missense probably damaging 1.00
R9790:Myo3b UTSW 2 70,180,287 (GRCm39) missense probably benign 0.35
R9791:Myo3b UTSW 2 70,180,287 (GRCm39) missense probably benign 0.35
U15987:Myo3b UTSW 2 70,069,243 (GRCm39) missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70,062,747 (GRCm39) missense probably benign 0.00
X0065:Myo3b UTSW 2 70,088,313 (GRCm39) missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70,088,371 (GRCm39) missense probably benign 0.01
Z1177:Myo3b UTSW 2 69,926,705 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGGGGTAGCCACATGTCTAG -3'
(R):5'- CTGATGCTCTAAACGATGAAAGAG -3'

Sequencing Primer
(F):5'- GGTAGCCACATGTCTAGGACCATAC -3'
(R):5'- ACGTAGGTCTAAGGCAAACTC -3'
Posted On 2021-08-02