Incidental Mutation 'R8909:Nbn'
ID 678492
Institutional Source Beutler Lab
Gene Symbol Nbn
Ensembl Gene ENSMUSG00000028224
Gene Name nibrin
Synonyms Nbs1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8909 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 15957925-15992589 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 15970833 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 272 (D272V)
Ref Sequence ENSEMBL: ENSMUSP00000029879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029879] [ENSMUST00000149069]
AlphaFold Q9R207
Predicted Effect probably damaging
Transcript: ENSMUST00000029879
AA Change: D272V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029879
Gene: ENSMUSG00000028224
AA Change: D272V

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
FHA 23 83 2.27e-4 SMART
BRCT 103 184 6.37e0 SMART
Pfam:NIBRIN_BRCT_II 216 325 2.2e-34 PFAM
low complexity region 557 565 N/A INTRINSIC
Nbs1_C 680 744 2.14e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000149069
AA Change: D272V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120829
Gene: ENSMUSG00000028224
AA Change: D272V

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
FHA 23 83 2.27e-4 SMART
BRCT 103 184 6.37e0 SMART
PDB:2K2W|A 217 326 3e-32 PDB
Meta Mutation Damage Score 0.7160 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are associated with Nijmegen breakage syndrome, an autosomal recessive chromosomal instability syndrome characterized by microcephaly, growth retardation, immunodeficiency, and cancer predisposition. The encoded protein is a member of the MRE11/RAD50 double-strand break repair complex which consists of 5 proteins. This gene product is thought to be involved in DNA double-strand break repair and DNA damage-induced checkpoint activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted mutations exhibit phenotypes ranging from impaired extraembryonic tissue growth and early embryonic death to growth retardation, lymphoid defects, lymphoma susceptibility, and failure of oogenesis. Null heterozygotes are cancer prone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik G T 13: 63,240,297 R698L possibly damaging Het
Btnl10 T C 11: 58,922,372 C276R probably benign Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Cavin4 G A 4: 48,672,421 G289R probably benign Het
Cdh9 T C 15: 16,848,524 F430S probably damaging Het
Cfh A G 1: 140,086,348 I1246T possibly damaging Het
Chd8 C T 14: 52,212,932 V1490M possibly damaging Het
Clec2g A G 6: 128,981,232 N137S probably benign Het
Cntn6 T A 6: 104,848,132 S878T probably benign Het
Cryga G T 1: 65,103,014 S73R probably benign Het
Dach1 T C 14: 98,168,684 D209G probably damaging Het
Duox2 A G 2: 122,296,381 S218P probably benign Het
Fbn2 T A 18: 58,059,436 Q1491L possibly damaging Het
Foxg1 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 12: 49,384,692 probably benign Het
Glra3 A T 8: 55,991,124 probably null Het
Helz A G 11: 107,666,008 D1284G possibly damaging Het
Iqsec3 G A 6: 121,413,159 A451V unknown Het
Kat6b A G 14: 21,669,146 T1189A probably benign Het
Lama1 T A 17: 67,772,741 F1203Y Het
Lingo2 A G 4: 35,708,349 S544P probably damaging Het
Llcfc1 T C 6: 41,684,591 V25A probably benign Het
Map1a A C 2: 121,298,910 H143P probably damaging Het
Mbd5 T C 2: 49,279,221 V1468A probably benign Het
Meis3 T A 7: 16,185,460 M367K possibly damaging Het
Mfsd7a C T 5: 108,444,566 V253I probably benign Het
Myo3b G A 2: 70,253,096 A698T probably damaging Het
Olfr1065 C T 2: 86,445,738 M81I possibly damaging Het
Olfr644 A G 7: 104,068,825 S69P probably damaging Het
Olfr683 C T 7: 105,144,042 V84I probably benign Het
Olfr835 G T 9: 19,035,592 M156I probably benign Het
Os9 C A 10: 127,120,956 probably null Het
Pard3b A G 1: 62,344,135 D796G probably benign Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Pkp4 A G 2: 59,354,414 E1180G possibly damaging Het
Plod1 T A 4: 147,927,106 K221* probably null Het
Ppp6r3 T C 19: 3,459,461 T795A probably benign Het
Pramef20 T C 4: 144,376,983 Q191R probably benign Het
Prokr2 T C 2: 132,373,803 E246G probably damaging Het
Psmb7 A G 2: 38,613,469 M178T probably damaging Het
Rbm39 C T 2: 156,177,777 probably benign Het
Saa1 T C 7: 46,741,349 N46S probably benign Het
Samd12 A G 15: 53,658,457 L119P probably damaging Het
Sdc3 A G 4: 130,818,783 E151G unknown Het
Serpina1a T C 12: 103,854,679 K370E probably damaging Het
Tnrc18 C A 5: 142,776,376 S681I Het
Ulk2 C T 11: 61,799,554 G636R probably benign Het
V1ra8 T C 6: 90,202,956 L47P possibly damaging Het
Wasf3 T C 5: 146,455,600 L160P Het
Wdr78 T G 4: 103,087,410 E248A possibly damaging Het
Zbtb34 A C 2: 33,411,689 V280G possibly damaging Het
Zfp646 T C 7: 127,879,343 Y231H probably damaging Het
Other mutations in Nbn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Nbn APN 4 15964320 missense probably benign 0.01
IGL00921:Nbn APN 4 15963833 missense possibly damaging 0.85
IGL01621:Nbn APN 4 15965221 missense probably benign 0.45
IGL02372:Nbn APN 4 15986613 missense probably benign 0.00
IGL03392:Nbn APN 4 15962362 missense probably damaging 1.00
nebish UTSW 4 15965132 critical splice acceptor site probably null
zenobia UTSW 4 15969391 missense probably damaging 1.00
R0238:Nbn UTSW 4 15986672 splice site probably benign
R0244:Nbn UTSW 4 15979353 missense probably benign 0.00
R0432:Nbn UTSW 4 15983951 unclassified probably benign
R0946:Nbn UTSW 4 15970719 critical splice acceptor site probably null
R1076:Nbn UTSW 4 15970719 critical splice acceptor site probably null
R1563:Nbn UTSW 4 15981668 missense possibly damaging 0.77
R1579:Nbn UTSW 4 15964289 missense probably damaging 0.99
R1660:Nbn UTSW 4 15971771 missense probably benign 0.06
R1663:Nbn UTSW 4 15970903 missense probably benign 0.13
R2005:Nbn UTSW 4 15979351 missense probably benign 0.01
R2010:Nbn UTSW 4 15969393 missense probably damaging 1.00
R2077:Nbn UTSW 4 15979389 missense probably damaging 1.00
R2228:Nbn UTSW 4 15970904 missense probably benign 0.01
R2229:Nbn UTSW 4 15970904 missense probably benign 0.01
R2356:Nbn UTSW 4 15970863 missense probably damaging 0.96
R2869:Nbn UTSW 4 15963810 missense probably damaging 1.00
R2869:Nbn UTSW 4 15963810 missense probably damaging 1.00
R3508:Nbn UTSW 4 15962387 missense probably damaging 1.00
R3745:Nbn UTSW 4 15976163 missense possibly damaging 0.67
R3753:Nbn UTSW 4 15964269 missense probably damaging 0.98
R4756:Nbn UTSW 4 15981470 missense probably benign 0.00
R5042:Nbn UTSW 4 15981446 missense probably benign 0.10
R5177:Nbn UTSW 4 15965132 critical splice acceptor site probably null
R5229:Nbn UTSW 4 15963893 missense probably damaging 0.98
R5368:Nbn UTSW 4 15969391 missense probably damaging 1.00
R5431:Nbn UTSW 4 15986593 missense probably benign
R6025:Nbn UTSW 4 15981347 missense probably damaging 0.97
R6375:Nbn UTSW 4 15979327 missense probably benign
R6543:Nbn UTSW 4 15986605 missense probably benign 0.39
R6655:Nbn UTSW 4 15981696 missense probably damaging 0.98
R6965:Nbn UTSW 4 15970863 missense probably benign 0.25
R7090:Nbn UTSW 4 15981350 missense probably benign 0.06
R7159:Nbn UTSW 4 15983677 splice site probably null
R7241:Nbn UTSW 4 15991190 missense probably benign 0.00
R7267:Nbn UTSW 4 15979320 missense probably benign 0.00
R7597:Nbn UTSW 4 15963911 missense probably damaging 1.00
R7937:Nbn UTSW 4 15958080 missense probably damaging 0.99
R8110:Nbn UTSW 4 15981588 missense probably benign 0.02
R8317:Nbn UTSW 4 15970893 missense probably damaging 0.96
R8327:Nbn UTSW 4 15981470 missense probably benign 0.00
R8725:Nbn UTSW 4 15963911 missense probably damaging 1.00
R8727:Nbn UTSW 4 15963911 missense probably damaging 1.00
R8747:Nbn UTSW 4 15981555 missense probably damaging 0.96
R8973:Nbn UTSW 4 15986585 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGAGAATGTGCTCAGAACC -3'
(R):5'- ATATTCCACTGCCTAGCATCG -3'

Sequencing Primer
(F):5'- GAATGTGCTCAGAACCCTCACTG -3'
(R):5'- TTCTCAAGAACATGGCCTGAC -3'
Posted On 2021-08-02