Incidental Mutation 'R8910:Dpyd'
ID 678538
Institutional Source Beutler Lab
Gene Symbol Dpyd
Ensembl Gene ENSMUSG00000033308
Gene Name dihydropyrimidine dehydrogenase
Synonyms DPD, E330028L06Rik
MMRRC Submission
Accession Numbers

Genbank: NM_170778; MGI: 2139667

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8910 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 118562129-119432924 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 118610518 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 38 (K38R)
Ref Sequence ENSEMBL: ENSMUSP00000039429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039177] [ENSMUST00000149101]
AlphaFold Q8CHR6
Predicted Effect probably benign
Transcript: ENSMUST00000039177
AA Change: K38R

PolyPhen 2 Score 0.171 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000039429
Gene: ENSMUSG00000033308
AA Change: K38R

DomainStartEndE-ValueType
Pfam:Fer4_20 55 168 4.6e-35 PFAM
Pfam:Pyr_redox_2 188 499 1.5e-15 PFAM
Pfam:NAD_binding_8 193 249 5.5e-8 PFAM
Pfam:DHO_dh 532 838 8.1e-36 PFAM
Pfam:Dus 617 822 7.5e-8 PFAM
Pfam:Fer4_10 945 997 7.4e-9 PFAM
Pfam:Fer4_21 946 1004 1.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149101
AA Change: K38R

PolyPhen 2 Score 0.171 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000143022
Gene: ENSMUSG00000033308
AA Change: K38R

DomainStartEndE-ValueType
PDB:1H7X|D 1 78 2e-40 PDB
SCOP:d1gtea1 2 78 3e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pyrimidine catabolic enzyme and the initial and rate-limiting factor in the pathway of uracil and thymidine catabolism. Mutations in this gene result in dihydropyrimidine dehydrogenase deficiency, an error in pyrimidine metabolism associated with thymine-uraciluria and an increased risk of toxicity in cancer patients receiving 5-fluorouracil chemotherapy. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik A G 13: 77,323,649 I1058V probably benign Het
3830406C13Rik A G 14: 12,285,444 H10R probably benign Het
Abca5 T C 11: 110,298,204 E809G probably damaging Het
Akap12 A T 10: 4,313,822 Q77L probably benign Het
Aldh5a1 A G 13: 24,918,616 V288A probably damaging Het
Alox5 C A 6: 116,412,549 E586* probably null Het
Arid5b A G 10: 68,098,278 F598S Het
Btc A C 5: 91,360,812 M157R probably benign Het
Cadps2 T C 6: 23,344,224 N908S probably benign Het
Cd244 C A 1: 171,559,373 H17N probably damaging Het
Cdh15 T C 8: 122,848,501 L5P probably benign Het
Cept1 A C 3: 106,539,249 S94A probably benign Het
Cntn4 T C 6: 106,655,536 M507T probably benign Het
Cpne4 A G 9: 104,922,507 probably benign Het
Dffb T C 4: 153,972,959 D87G possibly damaging Het
Dlgap1 C T 17: 70,786,820 T712I probably damaging Het
Dnhd1 A C 7: 105,683,697 H155P possibly damaging Het
Evx1 C T 6: 52,316,761 R305C probably damaging Het
Ezr A G 17: 6,755,900 L47P probably damaging Het
Fabp6 C T 11: 43,601,508 A2T possibly damaging Het
Fam78a G A 2: 32,069,669 T143M probably damaging Het
Fam83h C T 15: 76,002,995 G831D probably benign Het
Fermt2 G A 14: 45,464,932 A465V probably damaging Het
Fras1 T C 5: 96,567,996 S358P probably benign Het
Frem1 C A 4: 82,950,457 G1429V probably benign Het
Fst T A 13: 114,453,709 probably benign Het
Gfpt1 T C 6: 87,053,805 I57T probably benign Het
Gimap6 A G 6: 48,702,454 I216T probably damaging Het
Gm10267 T A 18: 44,156,444 N73I possibly damaging Het
Gm21188 T A 13: 120,046,820 probably benign Het
H2-M2 G A 17: 37,481,522 T286I probably damaging Het
Hgs T C 11: 120,478,376 probably null Het
Klra6 T C 6: 130,016,684 E208G probably benign Het
L3mbtl1 A T 2: 162,970,293 T753S probably benign Het
Larp6 A G 9: 60,713,243 E13G probably benign Het
Mroh2b A G 15: 4,931,373 I806V probably benign Het
Myo1g T C 11: 6,518,009 N142S possibly damaging Het
Myo3a A G 2: 22,574,268 T1112A probably benign Het
Olfr1272 C A 2: 90,296,504 R119L possibly damaging Het
Pelp1 A T 11: 70,396,635 M449K probably damaging Het
Ppp4r1 T C 17: 65,837,773 V795A probably damaging Het
Ppp4r3b G T 11: 29,196,290 M372I probably null Het
Ptprk T C 10: 28,492,997 V655A possibly damaging Het
Rad51d T C 11: 82,882,967 R166G probably damaging Het
Rbm19 T A 5: 120,133,779 Y650N probably damaging Het
Rreb1 A G 13: 37,948,765 K204E Het
Ryr1 A G 7: 29,071,915 L2567P probably damaging Het
Scn3a T A 2: 65,508,539 S599C probably damaging Het
Slc7a15 T A 12: 8,539,117 probably benign Het
Taf6 T C 5: 138,184,454 T12A probably benign Het
Tbc1d10b T C 7: 127,207,766 T200A probably benign Het
Tex21 C T 12: 76,216,759 probably benign Het
Thap4 T C 1: 93,714,944 H515R probably damaging Het
Tmem94 A G 11: 115,797,426 Q1237R probably damaging Het
Tppp3 A G 8: 105,468,292 V69A probably benign Het
Unc5a A G 13: 55,003,588 E695G possibly damaging Het
Wtip G A 7: 34,132,638 P141L possibly damaging Het
Wwp1 A T 4: 19,627,741 M718K possibly damaging Het
Zbtb25 A C 12: 76,349,134 V438G probably damaging Het
Zfp444 T C 7: 6,184,027 L46P probably damaging Het
Zfp521 T C 18: 13,844,176 H1060R probably benign Het
Zkscan14 A G 5: 145,195,380 F447S probably damaging Het
Other mutations in Dpyd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Dpyd APN 3 118944242 missense probably damaging 1.00
IGL00508:Dpyd APN 3 119064987 missense probably benign 0.06
IGL02113:Dpyd APN 3 118999219 missense probably benign 0.06
IGL02177:Dpyd APN 3 119064910 missense possibly damaging 0.76
IGL03001:Dpyd APN 3 118917242 missense probably benign 0.07
IGL03106:Dpyd APN 3 119195134 missense probably benign 0.03
IGL03399:Dpyd APN 3 119314777 missense probably damaging 0.98
F5770:Dpyd UTSW 3 118897126 nonsense probably null
F6893:Dpyd UTSW 3 118804134 critical splice donor site probably null
R0014:Dpyd UTSW 3 119141935 missense probably damaging 1.00
R0081:Dpyd UTSW 3 118944255 missense probably benign 0.00
R0267:Dpyd UTSW 3 118917272 missense probably benign
R0349:Dpyd UTSW 3 118917099 nonsense probably null
R0387:Dpyd UTSW 3 119427226 missense probably benign 0.21
R0523:Dpyd UTSW 3 118899203 missense probably benign
R0555:Dpyd UTSW 3 119431542 missense probably damaging 1.00
R0652:Dpyd UTSW 3 119427275 missense probably damaging 1.00
R0741:Dpyd UTSW 3 118674505 missense possibly damaging 0.79
R1313:Dpyd UTSW 3 118899161 splice site probably benign
R1554:Dpyd UTSW 3 119065046 splice site probably null
R1610:Dpyd UTSW 3 119065006 missense probably benign
R1710:Dpyd UTSW 3 118610443 critical splice acceptor site probably null
R1861:Dpyd UTSW 3 118917131 missense probably damaging 1.00
R2103:Dpyd UTSW 3 119064952 missense probably benign 0.02
R2130:Dpyd UTSW 3 118674568 missense probably benign
R2131:Dpyd UTSW 3 118674568 missense probably benign
R2882:Dpyd UTSW 3 119065030 missense probably damaging 0.99
R3771:Dpyd UTSW 3 119412278 critical splice donor site probably null
R3978:Dpyd UTSW 3 118897088 critical splice acceptor site probably benign
R3978:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4030:Dpyd UTSW 3 118897166 missense probably benign 0.03
R4065:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4066:Dpyd UTSW 3 118897089 critical splice acceptor site probably benign
R4234:Dpyd UTSW 3 119431584 missense probably damaging 1.00
R4502:Dpyd UTSW 3 118797537 missense probably damaging 1.00
R4638:Dpyd UTSW 3 119266077 missense probably benign 0.03
R4980:Dpyd UTSW 3 118917118 missense probably damaging 0.99
R5262:Dpyd UTSW 3 118797422 nonsense probably null
R5348:Dpyd UTSW 3 118781943 missense probably benign
R5587:Dpyd UTSW 3 119064951 missense probably damaging 1.00
R5611:Dpyd UTSW 3 119194293 missense probably benign
R5665:Dpyd UTSW 3 118917092 missense probably damaging 1.00
R5716:Dpyd UTSW 3 118899179 missense probably damaging 1.00
R5786:Dpyd UTSW 3 119427237 missense probably damaging 0.97
R6046:Dpyd UTSW 3 119431575 missense probably benign 0.01
R6404:Dpyd UTSW 3 119265957 missense probably benign 0.02
R6703:Dpyd UTSW 3 118897200 splice site probably null
R7037:Dpyd UTSW 3 118899289 missense probably benign 0.00
R7215:Dpyd UTSW 3 119266032 missense probably benign 0.11
R7301:Dpyd UTSW 3 118899284 missense possibly damaging 0.90
R7336:Dpyd UTSW 3 119064921 missense probably damaging 1.00
R7714:Dpyd UTSW 3 118804131 missense probably benign 0.01
R8238:Dpyd UTSW 3 119195193 splice site probably null
R8306:Dpyd UTSW 3 119412173 missense probably benign
R8315:Dpyd UTSW 3 119314885 missense probably benign 0.09
R8321:Dpyd UTSW 3 118781924 missense possibly damaging 0.84
R8342:Dpyd UTSW 3 119314803 missense possibly damaging 0.60
R8735:Dpyd UTSW 3 119141916 missense possibly damaging 0.74
R8750:Dpyd UTSW 3 119141936 missense probably damaging 1.00
R8874:Dpyd UTSW 3 118999332 missense probably damaging 1.00
R8973:Dpyd UTSW 3 119314933 critical splice donor site probably null
R9070:Dpyd UTSW 3 118999243 missense probably damaging 0.98
R9132:Dpyd UTSW 3 118917248 missense probably damaging 1.00
R9198:Dpyd UTSW 3 118759654 critical splice acceptor site probably null
R9260:Dpyd UTSW 3 119314798 missense possibly damaging 0.95
R9307:Dpyd UTSW 3 119314911 missense probably benign
V7581:Dpyd UTSW 3 118897126 nonsense probably null
V7582:Dpyd UTSW 3 118897126 nonsense probably null
V7583:Dpyd UTSW 3 118897126 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTCTCTTTAGGGAAATTGAGTGATC -3'
(R):5'- CAGCATGCTCTCATCGTACATAAC -3'

Sequencing Primer
(F):5'- ATCCTGGCTTTAAACCCTC -3'
(R):5'- CGAAGCATCAAAAACTTGTTTGCAG -3'
Posted On 2021-08-02